+7 (495) 720-06-54
Пн-пт: с 9:00 до 21:00, сб-вс: 10:00-18:00
Мы принимаем он-лайн заказы 24 часа*
 

Ухань онлайн табло: Online табло аэропорта Ухань Тианьхэ прилет

0

Онлайн табло Ухань (аэропорт города Ухань): расписание прилетов и вылетов

CA 8218 Airbus А320 Чжухай — Ухань Air China00:05, 19.03
CA 8286 Airbus А320 Чанчунь — Ухань Air China00:05, 19.03
CZ 3470 Boeing 737-800 Куньмин — Ухань China Southern Airlines00:15, 19.03
MU 2540 Boeing 737-800 Чунцин — Ухань China Eastern Airlines00:20, 19.03
CA 8228 Airbus А320 Сямынь — Ухань Air China00:25, 19.03
OQ 2069 Airbus A319 Тэнчун — Ухань Chongqing Airlines00:30, 19.03
MU 2582 Boeing 737-800 Бэйхай — Ухань China Eastern Airlines00:45, 19.03
MU 2654 Boeing 737-500 Чэнду — Ухань China Eastern Airlines00:50, 19. 03
MU 2528 Boeing 737-500 Санья — Ухань China Eastern Airlines01:35, 19.03
MU 2498 Boeing 737-800 Куньмин — Ухань China Eastern Airlines01:45, 19.03
OQ 2075 Airbus А320 Чунцин — Shennongjia Chongqing Airlines08:20, 19.03
MU 2125 Airbus А320 Сиань — Ухань China Eastern Airlines08:25, 19.03
CZ 3341 Boeing 737-800 Уданшань — Хайкоу China Southern Airlines08:35, 19.03
MU 6733 Boeing 737-500 Гуанчжоу — Датун China Eastern Airlines08:40, 19.03
SC 1195 Boeing 737-800 Цзинань — Ухань Shandong Airlines08:45, 19.03
MF 8485 Boeing 737-800 Ханчжоу — Наньчун Xiamen Airlines Company08:45, 19.03
MF 8373 Boeing 737-800 Сямынь — Ухань Xiamen Airlines Company08:50, 19.03
EU 2746 Airbus A319 Фучжоу — Лхаса Chengdu Airlines08:55, 19.03
MU 5371 Airbus A319 Шанхай — Ухань China Eastern Airlines08:55, 19.03
CZ 3841 Boeing 737-800 Эньши — Сямынь China Southern Airlines08:55, 19.03
OQ 2067 Airbus A319 Линьи — Наньнин Chongqing Airlines09:00, 19.03
MU 6631 Airbus А320 Нинбо — Синин China Eastern Airlines09:15, 19.03
MU 2510 Boeing 737-800 Шанхай — Ухань China Eastern Airlines09:25, 19.03
MF 8273 Boeing 737-800 Фучжоу — Синин Xiamen Airlines Company09:35, 19.03
9C 7039 Airbus А320 Шэньчжэнь — Ву-Хэй Spring Airlines09:35, 19.03
MF 8331 Boeing 737-800 Тяньцзинь — Наньнин Xiamen Airlines Company09:40, 19.03
JD 5781 Airbus А320 Лицзян — Ухань Beijing Capital Airlines09:45, 19.03
CZ 3785 Boeing 737-800 Гуйян — Линьи China Southern Airlines09:45, 19.03
MU 5885 Boeing 737-500 Лучжоу — Ухань China Eastern Airlines09:55, 19.03
SC 8849 Boeing 737-800 Цзинань — Учжоу Shandong Airlines10:00, 19.03
CZ 6317 Boeing 737-800 Наньнин — Харбин China Southern Airlines10:15, 19.03
CZ 8680 Boeing 737-800 Чэнду — Ухань China Southern Airlines10:25, 19.03
CZ 6425 Airbus А320 Далянь — Куньмин China Southern Airlines10:40, 19.03
ZH 9389 Boeing 737-800 Наньнин — Тайюань Shenzhen Airlines10:55, 19.03
HU 7187 Boeing 737-800 Пекин — Ухань Hainan Airlines11:20, 19.03
CZ 8722 Boeing 737-800 Гуанчжоу — Ухань China Southern Airlines11:20, 19.03
MU 2500 Boeing 737-800 Пекин — Ухань China Eastern Airlines11:20, 19.03
CZ 6291 Boeing 737-800 Чжухай — Ланьчжоу China Southern Airlines11:25, 19.03
MU 2639 Boeing 737-500 Чэнду — Иу China Eastern Airlines11:30, 19.03
MF 8645 Boeing 737-800 Иньчуань — Ухань Xiamen Airlines Company11:35, 19.03
AQ 1311 Boeing 737-800 Гуанчжоу — Чжанъе 9 Air11:50, 19.03
MU 2636 Boeing 737-500 Цзуньи — Ухань China Eastern Airlines11:55, 19.03
MU 2473 Boeing 737-500 Ланьчжоу — Нинбо China Eastern Airlines11:55, 19.03
MU 2658 Boeing 737-500 Чэнду — Ухань China Eastern Airlines11:55, 19.03
JD 5285 Airbus А320 Хайкоу — Ухань Beijing Capital Airlines12:05, 19.03
CZ 6176 Boeing 737-700 Чунцин — Ухань China Southern Airlines12:15, 19.03
JD 5583 Airbus А320 Шэньян — Куньмин Beijing Capital Airlines12:20, 19.03
MU 2460 Boeing 737-800 Пекин — Ухань China Eastern Airlines12:25, 19.03
MU 2622 Boeing 737-500 Дунъин — Ухань China Eastern Airlines12:30, 19.03
MU 2646 Boeing 737-500 Лонг-Пойнт — Ухань China Eastern Airlines12:30, 19.03
CZ 6939 Boeing 737-800 Урумчи — Сямынь China Southern Airlines12:40, 19.03
JD 5627 Airbus А321 Санья — Ухань Beijing Capital Airlines12:45, 19.03
CA 8222 Airbus А320 Чэнду — Ухань Air China12:50, 19.03
JR 1625 Xian MA-60 Дайонг — Ухань Joy Air12:50, 19.03
MU 2478 Boeing 737-500 Шэньчжэнь — Цзиньчжоу China Eastern Airlines12:50, 19.03
SC 4875 Boeing 737-800 Яньтай — Ухань Shandong Airlines12:55, 19.03
MU 2596 Boeing 737-800 Чжаньцзян — Ухань China Eastern Airlines12:55, 19.03
CA 8244 Airbus А320 Гуйян — Ухань Air China13:00, 19.03
MF 8215 Boeing 737-800 Фучжоу — Ланьчжоу Xiamen Airlines Company13:00, 19.03
OQ 2076 Airbus А320 Shennongjia — Чунцин Chongqing Airlines13:05, 19.03
MU 2506 Boeing 737 Шанхай — Ухань China Eastern Airlines13:10, 19.03
CA 8204 Boeing 737-800 Пекин — Ухань Air China13:10, 19.03
CZ 6899 Airbus А320 Далянь — Санья China Southern Airlines13:10, 19.03
MU 2624 Boeing 737-800 Чжоушань — Ухань China Eastern Airlines13:25, 19.03
MU 2481 Boeing 737-800 Куньмин — Рио-Алзукар China Eastern Airlines13:40, 19.03
MU 2557 Boeing 737-500 Цзиньчжоу — Шэньчжэнь China Eastern Airlines13:40, 19.03
MU 2633 Boeing 737-800 Бэйхай — Сюйчжоу China Eastern Airlines13:45, 19.03
CA 8236 Airbus А320 Хайкоу — Ухань Air China13:50, 19.03
GX 7862 Embraer 190 Ваньян — Ухань GX Airlines13:55, 19.03
CZ 3346 Boeing 737-800 Гуанчжоу — Ухань China Southern Airlines13:55, 19.03
MU 2610 Boeing 737-500 Вэньчжоу — Ухань China Eastern Airlines13:55, 19.03
JD 5297 Airbus А321 Хайкоу — Ухань Beijing Capital Airlines14:00, 19.03
MF 8486 Boeing 737-800 Наньчун — Ханчжоу Xiamen Airlines Company14:05, 19.03
MU 2452 Boeing 737 Пекин — Ухань China Eastern Airlines14:10, 19.03
CZ 3889 Boeing 737-800 Шаньтоу — Ухань China Southern Airlines14:20, 19.03
3U 3007 Airbus A319 Сон Пэн — Ухань Sichuan Airlines14:25, 19.03
CZ 3786 Boeing 737-800 Линьи — Гуйян China Southern Airlines14:30, 19.03
MU 2630 Boeing 737-800 Вэньчжоу — Ухань China Eastern Airlines14:35, 19.03
CA 8282 Airbus А320 Чэнду — Ухань Air China14:35, 19.03
CZ 3842 Boeing 737-800 Сямынь — Эньши China Southern Airlines14:40, 19.03
MF 8397 Boeing 737-800 Сямынь — Ухань Xiamen Airlines Company14:55, 19.03
MU 6734 Boeing 737-500 Датун — Гуанчжоу China Eastern Airlines14:55, 19.03
SC 8850 Boeing 737-800 Учжоу — Цзинань Shandong Airlines15:00, 19.03
CZ 5526 Boeing 737-700 Пекин — Ухань China Southern Airlines15:05, 19.03
MU 2469 Boeing 737-800 Шанхай — Эньши China Eastern Airlines15:05, 19.03
CZ 8576 Boeing 737-700 Куньмин — Ухань China Southern Airlines15:05, 19.03
OQ 2068 Airbus A319 Наньнин — Линьи Chongqing Airlines15:15, 19.03
MU 5479 Airbus А320 Циндао — Куньмин China Eastern Airlines15:20, 19.03
MU 2508 Boeing 737-800 Шанхай — Ухань China Eastern Airlines15:25, 19.03
CZ 8438 Boeing 737-800 Хайкоу — Ухань China Southern Airlines15:25, 19.03
CA 8206 Airbus А320 Пекин — Ухань Air China15:30, 19.03
HU 7063 Boeing 737-800 Хайкоу — Ухань Hainan Airlines15:35, 19.03
MF 8332 Boeing 737-800 Наньнин — Тяньцзинь Xiamen Airlines Company15:35, 19.03
MF 8619 Boeing 737-800 Цзиньцзян — Мяньян Xiamen Airlines Company15:40, 19.03
MU 2437 Boeing 737 Тайюань — Сямынь China Eastern Airlines15:40, 19.03
MU 6632 Airbus А320 Синин — Нинбо China Eastern Airlines15:50, 19.03
MF 8237 Boeing 737-800 Ханчжоу — Лучжоу Xiamen Airlines Company15:55, 19.03
MF 8274 Boeing 737-800 Синин — Фучжоу Xiamen Airlines Company16:05, 19.03
MU 2534 Boeing 737 Шанхай — Ухань China Eastern Airlines16:10, 19.03
8L 9893 Boeing 737-600 Куньмин — Ухань Lucky air16:10, 19.03

Аэропорт Ухань Тианьхэ WUH, онлайн табло прилёта и вылета, адрес где находится Wuhan Tianhe International Airport

OQ 2070Ухань — ТэнчунChongqing AirlinesAirbus A31906:30
MU 2602Ухань — ГуанчжоуChina Eastern AirlinesBoeing 737-50007:05
MU 2523Ухань — ШанхайChina Eastern AirlinesBoeing 737-80007:30
MU 2545Ухань — ШэньянChina Eastern AirlinesBoeing 737-50007:40
MU 2635Ухань — ЦзуньиChina Eastern AirlinesBoeing 737-50007:40
CA 8221Ухань — ЧэндуAir ChinaAirbus А32007:45
CA 8201Ухань — ПекинAir ChinaAirbus А32007:50
MU 2477Ухань — ШэньчжэньChina Eastern AirlinesBoeing 737-50007:55
MU 2497Ухань — КуньминChina Eastern AirlinesBoeing 737-80007:55
CZ 6175Ухань — ЧунцинChina Southern AirlinesBoeing 737-70008:00
MU 2595Ухань — ЧжаньцзянChina Eastern AirlinesBoeing 737-80008:00
CZ 3357Ухань — ШэньчжэньChina Southern AirlinesBoeing 737-70008:10
MU 2621Ухань — ДунъинChina Eastern AirlinesBoeing 737-50008:10
MU 2517Ухань — ДаляньChina Eastern AirlinesBoeing 737-50008:15
CA 8235Ухань — ХайкоуAir ChinaAirbus А32008:20
CZ 3845Ухань — ХайкоуChina Southern AirlinesBoeing 737-80008:20
CZ 3368Ухань — ГуанчжоуChina Southern AirlinesBoeing 737-80008:30
MU 2501Ухань — ШанхайChina Eastern AirlinesBoeing 73708:30
CA 8243Ухань — ГуйянAir ChinaAirbus А32008:35
CZ 8575Ухань — КуньминChina Southern AirlinesBoeing 737-80008:45
MU 2603Ухань — ГуйянChina Eastern AirlinesBoeing 737-50008:45
CZ 6633Ухань — Боро-ТалаChina Southern AirlinesBoeing 737-80008:55
MU 2451Ухань — ПекинChina Eastern AirlinesBoeing 73708:55
CA 8281Ухань — ЧэндуAir ChinaAirbus А32009:00
MU 2581Ухань — БэйхайChina Eastern AirlinesBoeing 737-80009:00
MU 2623Ухань — ЧжоушаньChina Eastern AirlinesBoeing 737-80009:05
CZ 5525Ухань — ПекинChina Southern AirlinesBoeing 737-70009:25
MU 2126Ухань — СианьChina Eastern AirlinesAirbus А32009:25
MU 2511Ухань — ШанхайChina Eastern AirlinesBoeing 737-80009:30
CZ 3341Уданшань — ХайкоуChina Southern AirlinesBoeing 737-80009:35
OQ 2075Чунцин — ShennongjiaChongqing AirlinesAirbus А32009:35
MU 6733Гуанчжоу — ДатунChina Eastern AirlinesBoeing 737-50009:40
MU 2537Ухань — ХарбинChina Eastern AirlinesBoeing 737-80009:45
SC 1196Ухань — ЦзинаньShandong AirlinesBoeing 737-80009:45
MF 8374Ухань — СямыньXiamen Airlines CompanyBoeing 737-80009:50
MF 8485Ханчжоу — НаньчунXiamen Airlines CompanyBoeing 737-80009:50
CZ 3841Эньши — СямыньChina Southern AirlinesBoeing 737-80009:55
OQ 2067Линьи — НаньнинChongqing AirlinesAirbus A31909:55
MU 2611Ухань — ЧэндуChina Eastern AirlinesBoeing 737-50010:00
CZ 8695Ухань — УрумчиChina Southern AirlinesBoeing 737-80010:05
EU 2746Фучжоу — ЛхасаChengdu AirlinesAirbus A31910:05
MU 5372Ухань — ШанхайChina Eastern AirlinesAirbus A31910:10
MU 6631Нинбо — СининChina Eastern AirlinesAirbus А32010:15
CA 8203Ухань — ПекинAir ChinaAirbus А32010:30
MU 2507Ухань — ШанхайChina Eastern AirlinesBoeing 737-80010:30
MU 2629Ухань — ВэньчжоуChina Eastern AirlinesBoeing 737-80010:30
MF 8273Фучжоу — СининXiamen Airlines CompanyBoeing 737-80010:35
9C 7039Шэньчжэнь — Ву-ХэйSpring AirlinesAirbus А32010:40
MF 8331Тяньцзинь — НаньнинXiamen Airlines CompanyBoeing 737-80010:40
CZ 3785Гуйян — ЛиньиChina Southern AirlinesBoeing 737-80010:45
SC 8849Цзинань — УчжоуShandong AirlinesBoeing 737-80011:00
CZ 6317Наньнин — ХарбинChina Southern AirlinesBoeing 737-80011:15
JD 5782Ухань — ЛицзянBeijing Capital AirlinesAirbus А32011:15
MU 5886Ухань — ЛучжоуChina Eastern AirlinesBoeing 737-50011:25
CZ 6425Далянь — КуньминChina Southern AirlinesAirbus А32011:40
ZH 9389Наньнин — ТайюаньShenzhen AirlinesBoeing 737-80011:55
CZ 3137Ухань — ПекинChina Southern AirlinesBoeing 737-80012:00
CZ 3345Ухань — ГуанчжоуChina Southern AirlinesBoeing 737-80012:00
CA 8283Ухань — ЧэндуAir ChinaAirbus А32012:15
CZ 6291Чжухай — ЛаньчжоуChina Southern AirlinesBoeing 737-80012:25
CA 8205Ухань — ПекинAir ChinaAirbus А32012:30
HU 7066Ухань — ХайкоуHainan AirlinesBoeing 737-80012:30
MU 2641Ухань — ЦзинаньChina Eastern AirlinesBoeing 737-80012:30
MF 8646Ухань — ИньчуаньXiamen Airlines CompanyBoeing 737-80012:35
MU 2639Чэнду — ИуChina Eastern AirlinesBoeing 737-50012:35
AQ 1311Гуанчжоу — Чжанъе9 AirBoeing 737-80012:50
MU 2473Ланьчжоу — НинбоChina Eastern AirlinesBoeing 737-50012:55
MU 2597Ухань — ШехдиChina Eastern AirlinesBoeing 737-50012:55
8L 9894Ухань — КуньминLucky airBoeing 73713:00
CZ 6285Ухань — ЧунцинChina Southern AirlinesBoeing 737-70013:15
JD 5583Шэньян — КуньминBeijing Capital AirlinesAirbus А32013:20
JD 5286Ухань — ХайкоуBeijing Capital AirlinesAirbus А32013:25
MU 2453Ухань — ПекинChina Eastern AirlinesBoeing 737-80013:25
MU 2521Ухань — ШанхайChina Eastern AirlinesBoeing 737-50013:30
MU 2651Ухань — ЧэндуChina Eastern AirlinesBoeing 737-50013:30
CZ 6939Урумчи — СямыньChina Southern AirlinesBoeing 737-80013:45
JD 5627Санья — ШэньянBeijing Capital AirlinesAirbus А32013:45
MU 2478Шэньчжэнь — ЦзиньчжоуChina Eastern AirlinesBoeing 737-50013:50
CZ 3837Ухань — НинбоChina Southern AirlinesBoeing 737-80013:55
SC 4875Яньтай — УханьShandong AirlinesBoeing 737-80013:55
CA 8231Ухань — ГуанчжоуAir ChinaAirbus А32014:00
CZ 8725Ухань — ГуанчжоуChina Southern AirlinesBoeing 737-80014:00
JR 1626Ухань — ДайонгXian MA-6014:00
CZ 3925Ухань — ХанчжоуChina Southern AirlinesBoeing 737-80014:05
MF 8215Фучжоу — ЛаньчжоуXiamen Airlines CompanyBoeing 737-80014:05
CZ 6899Далянь — СаньяChina Southern AirlinesAirbus А32114:10
MU 2617Ухань — ЮньчэнChina Eastern AirlinesBoeing 73714:10
MU 2539Ухань — ЧунцинChina Eastern AirlinesBoeing 737-80014:15
OQ 2076Shennongjia — ЧунцинChongqing AirlinesAirbus А32014:15
CA 8207Ухань — ПекинAir ChinaBoeing 737-80014:30
CZ 8863Ухань — ПекинChina Southern AirlinesBoeing 737-70014:30
MU 2481Куньмин — Рио-АлзукарChina Eastern AirlinesBoeing 737-80014:40
MU 2557Цзиньчжоу — ШэньчжэньChina Eastern AirlinesBoeing 737-50014:40
MU 2633Бэйхай — СюйчжоуChina Eastern AirlinesBoeing 737-80014:50
CA 8247Ухань — ШэньянAir ChinaAirbus А32014:55
CZ 3579Ухань — ШанхайChina Southern AirlinesBoeing 737-80014:55
CZ 8559Ухань — ХойчжоуChina Southern AirlinesBoeing 737-80014:55
GX 7861Ухань — ВаньянEmbraer 19015:00
JD 5298Ухань — ХайкоуBeijing Capital AirlinesAirbus А32115:00
MF 8486Наньчун — ХанчжоуXiamen Airlines CompanyBoeing 737-80015:05
3U 3008Ухань — Сон ПэнSichuan AirlinesAirbus A31915:30
MU 2533Ухань — ШанхайChina Eastern AirlinesBoeing 737-80015:30
MU 2605Ухань — ЧэндуChina Eastern AirlinesBoeing 73715:35
CZ 8287Гуйян — ДаляньChina Southern AirlinesBoeing 737-80015:45
CZ 3842Сямынь — ЭньшиChina Southern AirlinesBoeing 737-80015:50
MU 2628Ухань — ЮйлиньChina Eastern AirlinesBoeing 737-50015:50
CZ 3139Ухань — ПекинChina Southern AirlinesBoeing 737-80015:55
CZ 3786Линьи — ГуйянChina Southern AirlinesBoeing 737-80015:55
MU 6734Датун — ГуанчжоуChina Eastern AirlinesBoeing 737-50015:55
MF 8398Ухань — СямыньXiamen Airlines CompanyBoeing 737-80016:00
MU 2469Шанхай — ЭньшиChina Eastern AirlinesBoeing 737-80016:05
SC 8850Учжоу — ЦзинаньShandong AirlinesBoeing 737-80016:05
CZ 8437Ухань — ХайкоуChina Southern AirlinesBoeing 737-80016:10
OQ 2068Наньнин — ЛиньиChongqing AirlinesAirbus A31916:15
CZ 8727Ухань — ГуанчжоуChina Southern AirlinesBoeing 737-80016:25
CA 8209Ухань — ПекинAir ChinaAirbus А32016:30
CA 8285Ухань — ЧанчуньAir ChinaAirbus А32016:30
MU 2505Ухань — ШанхайChina Eastern AirlinesBoeing 737-80016:30
MF 8332Наньнин — ТяньцзиньXiamen Airlines CompanyBoeing 737-80016:40
MF 8619Цзиньцзян — МяньянXiamen Airlines CompanyBoeing 737-80016:40
CZ 5629Ухань — НинбоChina Southern AirlinesBoeing 737-70016:55
MU 5479Циндао — КуньминChina Eastern AirlinesAirbus А32016:55
MF 8237Ханчжоу — ЛучжоуXiamen Airlines CompanyBoeing 737-80017:00
MU 2437Тайюань — СямыньChina Eastern AirlinesBoeing 73717:00
MU 6632Синин — НинбоChina Eastern AirlinesAirbus А32017:00
MF 8274Синин — ФучжоуXiamen Airlines CompanyBoeing 737-80017:10
EU 2711Чэнду — ХуанъяньChengdu AirlinesAirbus А32017:15
MU 2485Ухань — КуньминChina Eastern AirlinesBoeing 73717:15
MU 2609Ухань — ВэньчжоуChina Eastern AirlinesBoeing 737-50017:20
CZ 5527Ухань — ПекинChina Southern AirlinesBoeing 737-70017:25
CZ 3347Ухань — ГуанчжоуChina Southern AirlinesBoeing 737-80017:30
CZ 3441Ухань — ЧэндуChina Southern AirlinesBoeing 737-80017:30
MU 2593Ухань — ХайкоуChina Eastern AirlinesBoeing 737-80017:40
MU 2455Ухань — ПекинChina Eastern AirlinesBoeing 737-80017:50
ZH 9390Тайюань — НаньнинShenzhen AirlinesBoeing 737-80017:50
HU 6006Ухань — ПекинHainan AirlinesBoeing 737-80017:55
MU 5374Ухань — ШанхайChina Eastern AirlinesAirbus A31917:55
CZ 3783Ухань — ХанчжоуChina Southern AirlinesBoeing 737-80018:05
MU 2474Нинбо — ЛаньчжоуChina Eastern AirlinesBoeing 737-50018:05
CZ 8661Ухань — ЧунцинChina Southern AirlinesBoeing 737-70018:20
MU 2513Ухань — ШанхайChina Eastern AirlinesBoeing 737-50018:30
MU 2640Иу — ЧэндуChina Eastern AirlinesBoeing 737-50018:30
CZ 6426Куньмин — ДаляньChina Southern AirlinesAirbus А32018:35
CZ 3469Ухань — КуньминChina Southern AirlinesBoeing 737-80018:40
SC 4924Ухань — ЦзинаньShandong AirlinesBoeing 737-80018:45
CA 8211Ухань — ПекинAir ChinaAirbus А32018:50
CA 8217Ухань — ЧжухайAir ChinaAirbus А32019:00
CZ 6292Ланьчжоу — ЧжухайChina Southern AirlinesBoeing 737-80019:00
CZ 5458Ухань — ШэньчжэньChina Southern AirlinesAirbus А32119:10
MU 2527Ухань — СаньяChina Eastern AirlinesBoeing 737-50019:20
CZ 3643Ухань — ЧунцинChina Southern AirlinesBoeing 737-80019:30
MU 2543Ухань — ШанхайChina Eastern AirlinesBoeing 73719:30
MU 2653Ухань — ЧэндуChina Eastern AirlinesBoeing 737-50019:30
BK 3214Ухань — НаньнинOkay airwaysBoeing 737-50019:35
CA 8249Ухань — ГуанчжоуAir ChinaAirbus А32019:35
MU 2634Сюйчжоу — БэйхайChina Eastern AirlinesBoeing 737-80019:40
SC 4876Гуйян — ЯньтайShandong AirlinesBoeing 737-80019:40
CA 8227Ухань — СямыньAir ChinaAirbus А32019:45
MU 2499Ухань — ПекинChina Eastern AirlinesBoeing 737-80019:50
CZ 6590Эньши — ГуанчжоуChina Southern AirlinesBoeing 737-80020:00
CZ 6940Сямынь — УрумчиChina Southern AirlinesBoeing 737-80020:00
CZ 5518Ухань — СаньяChina Southern AirlinesAirbus А32020:05
JD 5584Куньмин — ШэньянBeijing Capital AirlinesAirbus А32020:05
MU 2482Рио-Алзукар — КуньминChina Eastern AirlinesBoeing 737-80020:10
MU 2589Ухань — ЧжаньцзянChina Eastern AirlinesBoeing 737-50020:10
CZ 6318Харбин — НаньнинChina Southern AirlinesBoeing 737-80020:15
MF 8216Ланьчжоу — ФучжоуXiamen Airlines CompanyBoeing 737-80020:15
9C 7040Ву-Хэй — ШэньчжэньSpring AirlinesAirbus А32020:20
HU 7188Ухань — ПекинHainan AirlinesBoeing 737-80020:20
MU 2657Ухань — ЧэндуChina Eastern AirlinesBoeing 737-50020:30
CA 4588Ухань — ЧэндуAir ChinaAirbus А330-20020:50
MU 2470Эньши — ШанхайChina Eastern AirlinesBoeing 737-80021:00
CA 4382Ухань — ЧунцинAir ChinaBoeing 737-80021:05
CZ 3890Ухань — ШаньтоуChina Southern AirlinesBoeing 737-80021:05
MU 6440Ухань — ДуншэнChina Eastern AirlinesAirbus А32121:15
CZ 3541Ухань — КуньминChina Southern AirlinesBoeing 737-80021:20
FM 9364Ухань — ШанхайShanghai AirlinesBoeing 73721:30
CZ 6900Санья — ДаляньChina Southern AirlinesAirbus А32121:35
JD 5528Ухань — ЦиндаоBeijing Capital AirlinesAirbus А32021:45
MF 8178Ухань — ПекинXiamen Airlines CompanyBoeing 737-80021:55
EU 2745Лхаса — ФучжоуChengdu AirlinesAirbus A31922:00
HU 7064Ухань — ХайкоуHainan AirlinesBoeing 737-80022:00
MU 5134Ухань — ТайюаньChina Eastern AirlinesBoeing 73722:00
8L 9824Ухань — ЛицзянLucky airAirbus A320 NEO22:05
CZ 8679Ухань — ЧэндуChina Southern AirlinesBoeing 737-80022:10
MU 5688Ухань — ВэньчжоуChina Eastern AirlinesBoeing 737-80022:10
MF 8620Мяньян — ЦзиньцзянXiamen Airlines CompanyBoeing 737-80022:15
JD 5628Ухань — СаньяBeijing Capital AirlinesAirbus А32122:20
JD 5706Ухань — ХайкоуBeijing Capital AirlinesAirbus А32022:35
MF 8238Лучжоу — ХанчжоуXiamen Airlines CompanyBoeing 737-80022:35
CZ 8288Далянь — ГуйянChina Southern AirlinesBoeing 737-80022:40
AQ 1312Чжанъе — Гуанчжоу9 AirBoeing 737-80022:45
8L 9900Ухань — КуньминLucky airBoeing 737-60022:55
EU 2712Хуанъянь — ЧэндуChengdu AirlinesAirbus А32023:00
MU 2438Сямынь — ТайюаньChina Eastern AirlinesBoeing 73723:00
CZ 6589Гуанчжоу — ЭньшиChina Southern AirlinesBoeing 737-80023:05
CZ 3342Хайкоу — УданшаньChina Southern AirlinesBoeing 737-80023:10
JD 5840Ухань — ЛицзянBeijing Capital AirlinesAirbus A31923:10
MU 5480Куньмин — ЦиндаоChina Eastern AirlinesAirbus А32023:50

Расписание самолетов Ухань – Москва 2022 цены прямые рейсы

Чтобы увидеть расписание прямых рейсов из Уханя в Москву на 2022 год, заполните форму поиска и укажите:
  • Город или аэропорт вылета — Ухань
  • Город прибытия — Москва
  • Дату вылета
  • Дату возвращения
  • Количество пассажиров
  • Класс обслуживания
  • Нажмите на кнопку «Найти билеты».
  • Через пару секунд система поиска покажет вам расписание самолетов Ухань – Москва и цены на билеты на сегодня, и вы сможете купить авиабилеты онлайн.
  • Оплатить билеты на самолет Ухань – Москва можно любым удобным для вас способом.
  • После оплаты электронные авиабилеты на рейс из Уханя в Москву будут отправлены на ваш E-mail.
  • Загрузите электронные билеты на самолет в свой мобильный телефон или распечатайте их на принтере и возьмите с собой в аэропорт.
  • Для регистрации на рейс и посадки в самолет Ухань – Москва понадобится только паспорт.

Расписание прямых рейсов Ухань – Москва 2022

Самый быстрый способ, как добраться из Уханя в Москву – это прямой рейс. В таблице представлено расписание самолетов на 2022 год, названия авиакомпаний, выполняющих прямые чартерные и регулярные рейсы из Уханя в Москву, частота перелетов, по каким дням недели и в какое время осуществляются вылеты и прибытия самолетов. Расписание самолетов включает чартерные рейсы Ухань – Москва, обычные регулярные перелеты и авиарейсы лоукост-компаний.


Сколько лететь из Уханя в Москву?

В выше расположенной таблице указано время вылета самолета из Уханя, время прибытия в Москву, и длительность прямого перелета из Уханя в Москву.

Время перелета в Москву из Уханя с одной пересадкой будет зависеть от продолжительности стыковки, т.е. ко времени прямого перелета нужно еще будет добавить время ожидания в аэропорту, где проходит пересадка. Точное время перелета с пересадкой можно увидеть на табло, где показаны рейсы из Уханя в Москву с пересадкой.

В таблице авиарейсов показано расстояние из Уханя в Москву в километрах, а также дни вылетов чартерных рейсов и обычных регулярных авиарейсов.

Подписка на расписание самолетов Ухань – Москва

Чтобы оперативно узнавать об актуальном расписании самолетов и о появлении дешевых билетов на прямой рейс Ухань – Москва, советуем подписаться на бесплатную рассылку уведомлений.

Календарь авиарейсов из Уханя в Москву на 2022 год

Данный календарь поможет найти самый дешевый авиабилет из Уханя в Москву на 2022 год. Укажите в меню, если вы ищете билеты из Уханя в Москву в одну сторону или туда и обратно. Также поставьте галочку напротив пункта «Только прямые рейсы», если перелеты из Уханя в Москву с пересадками вас не интересуют.

Loukoster.com покажет самое актуальное расписание самолетов Ухань – Москва в обе стороны. Мы анализируем график авиарейсов 1139 авиакомпаний мира и показываем вам самые удобные перелеты из Уханя в Москву. У какого авиаперевозчика покупать билеты на самолет из Уханя в Москву – решаете вы вами.

Больше всего рейсов по направлению Ухань – Москва производятся в мае, июле, августе и сентябре, т.е. на майские праздники и в летние отпуска. В эту пору года цена авиабилетов будет выше средней планки.

В сентябре, октябре, ноябре и начале декабря, на графике рейсов видно, что самолеты по маршруту Ухань – Москва летают реже, чем обычно, а стоимость авиабилетов опускается ниже средних показателей.

В конце декабря, в январе и феврале, в период Новогодних праздников и зимних отпусков, в расписании самолетов появляется больше рейсов из Уханя в Москву, чем обычно, а цена авиабилетов опять вырастает выше среднего уровня.

В марте и апреле в расписании самолетов количество перелетов по направлению Ухань – Москва опускается ниже средних показателей.

Расписание рейсов самолетов из Уханя в Москву на сегодня

Если на сегодня есть рейсы из Уханя в Москву, то ниже на табло вылета и прибытия будет показано расписание самолетов Ухань – Москва на сегодня, завтра и ближайшие дни.

График перелетов из Уханя в Москву с пересадкой

Существует альтернатива, как добраться из Уханя в Москву (туда и обратно) – и это перелеты с пересадкой. Выгодой таких рейсов является то, что цена билетов на рейсы, как правило, ниже, чем на прямые перелеты. В таблице представлено расписание авиарейсов Ухань – Москва с одной пересадкой.

Loukoster.com советует бронировать авиабилеты из Уханя в Москву заблаговременно, так как чем ближе дата вылета, тем выше стоимость билетов на самолет. Также это позволить зарезервировать лучшие места на борту самолета.
В расписании рейсов из Уханя в Москву на год вперед видно, что в период летних и зимних каникул и отпусков, цена билетов на самолет Ухань – Москва вырастает, а в межсезонье – падает. Воспользуйтесь этой информацией, чтобы заранее спланировать будущее путешествие!

Онлайн-табло вылета самолетов из Уханя

На табло вылета показано в какие города летают самолеты из аэропорта «Ухань» и какая стоимость авиабилетов.

Онлайн-табло прилета самолетов в Москву

На табло прилета аэропорта «Москва» в режиме онлайн можно увидеть из каких городов летают самолеты в Москву и какие цены на билеты.

Расписание самолетов на обратный прямой рейс Москва – Ухань

В таблице представлено расписание самолетов на обратный прямой рейс Москва – Ухань. Представлены чартерные рейсы Москва – Ухань, регулярные перелеты и авиарейсы лоукостеров.


Все рейсы из Уханя в Москву отменили из-за вспышки коронавируса

https://ria.ru/20200124/1563817871.html

Все рейсы из Уханя в Москву отменили из-за вспышки коронавируса

Все рейсы из Уханя в Москву отменили из-за вспышки коронавируса — РИА Новости, 24.01.2020

Все рейсы из Уханя в Москву отменили из-за вспышки коронавируса

Все авиарейсы в Москву из китайского города Ухань, охваченного новым типом коронавируса, отменены, сообщили РИА Новости в международном аэропорту Уханя… РИА Новости, 24.01.2020

2020-01-24T11:45

2020-01-24T11:45

2020-01-24T14:55

в мире

ухань

китай

москва

распространение коронавируса

новости — туризм

туризм

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/156374/60/1563746090_0:458:2827:2048_1920x0_80_0_0_8bdcaac40e139a3f47d0be61f9a2d0f0.jpg

ПЕКИН, 24 янв – РИА Новости. Все авиарейсы в Москву из китайского города Ухань, охваченного новым типом коронавируса, отменены, сообщили РИА Новости в международном аэропорту Уханя «Тяньхэ».На уточняющий вопрос, касается ли это только прямых рейсов, представитель аэропорта подчеркнула, что «отменены все рейсы».Из данных онлайн-табло московского аэропорта «Шереметьево» следует, что рейсов в Ухань и обратно сегодня не запланировано. Рейсов по этому направлению из «Домодедово» и «Внуково» не было.Город Ухань с населением в 11 миллионов человек с утра четверга фактически изолирован из-за вспышки заболевания, транспортное сообщение в городе приостановлено, включая метро, автобусы, паромы, в город не впускают автобусы и водный транспорт, вылеты из аэропорта города и отправления с железнодорожных станций также отменены, власти города и страны рекомендуют не ездить туда и не выезжать из города без особых причин.

https://radiosputnik.ria.ru/20200124/1563817023.html

ухань

китай

москва

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/156374/60/1563746090_112:0:2843:2048_1920x0_80_0_0_c454f0240ca55a25775fac8d36881a84.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

в мире, ухань, китай, москва, новости — туризм, туризм

ПЕКИН, 24 янв – РИА Новости. Все авиарейсы в Москву из китайского города Ухань, охваченного новым типом коронавируса, отменены, сообщили РИА Новости в международном аэропорту Уханя «Тяньхэ».

«Да, все рейсы отменены, улететь невозможно», — сообщили РИА Новости в службе поддержки аэропорта.

На уточняющий вопрос, касается ли это только прямых рейсов, представитель аэропорта подчеркнула, что «отменены все рейсы».

24 января 2020, 11:29

«Усилить меры». ВОЗ дала рекомендации из-за вспышки коронавируса в КНР

Из данных онлайн-табло московского аэропорта «Шереметьево» следует, что рейсов в Ухань и обратно сегодня не запланировано. Рейсов по этому направлению из «Домодедово» и «Внуково» не было.

Город Ухань с населением в 11 миллионов человек с утра четверга фактически изолирован из-за вспышки заболевания, транспортное сообщение в городе приостановлено, включая метро, автобусы, паромы, в город не впускают автобусы и водный транспорт, вылеты из аэропорта города и отправления с железнодорожных станций также отменены, власти города и страны рекомендуют не ездить туда и не выезжать из города без особых причин.

Скрытая угроза: вспышка нового коронавируса в Китае

1 из 13

О вспышке пневмонии неизвестного происхождения в городе Ухань китайские власти сообщили в конце декабря.

© REUTERS / Eloisa Lopez

Специалисты установили возбудителя болезни — коронавирус 2019-nCoV.

2 из 13

Специалисты установили возбудителя болезни — коронавирус 2019-nCoV.

© REUTERS / Carlos Garcia Rawlins

Счет заболевших идет на тысячи. Для нескольких сотен пациентов вирус оказался смертельным.

3 из 13

Счет заболевших идет на тысячи. Для нескольких сотен пациентов вирус оказался смертельным.

© REUTERS / China News Service

В Ухане ввели карантин. Общественный транспорт не работает, въезд в город и выезд из него запрещены.

4 из 13

В Ухане ввели карантин. Общественный транспорт не работает, въезд в город и выезд из него запрещены.

© AP Photo / Ahn Young-joon

В провинции Хубей, где находится очаг вируса, и в китайской столице объявили наивысший уровень реагирования на чрезвычайные ситуации, связанные со здоровьем.

5 из 13

В провинции Хубей, где находится очаг вируса, и в китайской столице объявили наивысший уровень реагирования на чрезвычайные ситуации, связанные со здоровьем.

© AP Photo / Dake Kang

Власти Китая подтвердили, что новый коронавирус передается от человека к человеку.

6 из 13

Власти Китая подтвердили, что новый коронавирус передается от человека к человеку.

© AP Photo / Kin Cheung

Вирус распространился за пределы страны. Случаи заражения зафиксированы в Южной Корее, Японии, США, Вьетнаме, Сингапуре и Таиланде.

7 из 13

Вирус распространился за пределы страны. Случаи заражения зафиксированы в Южной Корее, Японии, США, Вьетнаме, Сингапуре и Таиланде.

© REUTERS / China Daily

Всемирная организация здравоохранения посоветовала всем странам быть готовыми к сдерживанию коронавируса.

8 из 13

Всемирная организация здравоохранения посоветовала всем странам быть готовыми к сдерживанию коронавируса.

© AP Photo / Ahn Young-joon

Авиавласти Китая уведомили перевозчиков о необходимости следить за ситуацией и при необходимости сокращать рейсы в Ухань.

9 из 13

Авиавласти Китая уведомили перевозчиков о необходимости следить за ситуацией и при необходимости сокращать рейсы в Ухань.

© REUTERS / Murad Sezer

Роспотребнадзор рекомендовал туристам воздержаться от поездок в Китай.

10 из 13

Роспотребнадзор рекомендовал туристам воздержаться от поездок в Китай.

© REUTERS / China Daily

При первых признаках заболевания специалисты советуют обращаться за медицинской помощью и не лечиться самим.

11 из 13

При первых признаках заболевания специалисты советуют обращаться за медицинской помощью и не лечиться самим.

12 из 13

В России подозрения на заражение пока не подтвердились.

13 из 13

Проверки на всех въездах в страну усилили. Пассажиры, прилетевшие из Китая, проходят дополнительный эпидемиологический контроль.

1 из 13

О вспышке пневмонии неизвестного происхождения в городе Ухань китайские власти сообщили в конце декабря.

2 из 13

Специалисты установили возбудителя болезни — коронавирус 2019-nCoV.

3 из 13

Счет заболевших идет на тысячи. Для нескольких сотен пациентов вирус оказался смертельным.

4 из 13

В Ухане ввели карантин. Общественный транспорт не работает, въезд в город и выезд из него запрещены.

5 из 13

В провинции Хубей, где находится очаг вируса, и в китайской столице объявили наивысший уровень реагирования на чрезвычайные ситуации, связанные со здоровьем.

6 из 13

Власти Китая подтвердили, что новый коронавирус передается от человека к человеку.

7 из 13

Вирус распространился за пределы страны. Случаи заражения зафиксированы в Южной Корее, Японии, США, Вьетнаме, Сингапуре и Таиланде.

8 из 13

Всемирная организация здравоохранения посоветовала всем странам быть готовыми к сдерживанию коронавируса.

9 из 13

Авиавласти Китая уведомили перевозчиков о необходимости следить за ситуацией и при необходимости сокращать рейсы в Ухань.

10 из 13

Роспотребнадзор рекомендовал туристам воздержаться от поездок в Китай.

11 из 13

При первых признаках заболевания специалисты советуют обращаться за медицинской помощью и не лечиться самим.

12 из 13

В России подозрения на заражение пока не подтвердились.

13 из 13

Проверки на всех въездах в страну усилили. Пассажиры, прилетевшие из Китая, проходят дополнительный эпидемиологический контроль.

описание, расположение, маршруты на карте

Китай посещают почти 60 миллионов туристов в год. Для их приёма в стране работает более 200 аэропортов, многие из них считаются лучшими и крупнейшими в мире, например, Шоуду в Пекине уступает лишь Атланте в США.

Аэропорт Шоуду

Размерами впечатляют также аэропорт Чэнду (Ченгду)Пудун в Шанхае и воздушная гавань в Гонконге.

Основные аэропорты Китая

Главные международные аэропорты Китая находятся в крупных городах: Пекине, Шанхае, Гонконге, Гуанчжоу, Ухане. Более мелкие города также имеют свои воздушные гавани, пассажиропоток которых слегка уступает столичным.

Аэропорт Ухань (встречается также название Вухан) является главным в провинции Хубей, находится в 26 км от центра города Ухань (Wuhan). Открылся в 1965 году, является одним из крупнейших в КНР. Один из самых загруженных аэропортов в центральном Китае, в год обслуживает примерно 12 млн человек. Имеет одну взлетно-посадочную полосу длиной 3400 м.

Контакты:

  • Адрес: Дорога аэропорта Тяньхэ, город Ухань, провинция Хубэй.
  • Код ИКАО: ZHHH.
  • Код ИАТА: WUH.
  • Время работы: круглосуточно.
  • Сайт аэропорта WUH: нет.
  • Телефон: +86 27 96577.

Второй, не менее важный аэроузел Китая — Ченгду, или Шуанлю. Это крупнейший транспортный узел на Севере в провинции Сычуань, находится в 20 км от центра города Ченгду (Chengdu). Открылся в 1956 году, занимает пятое место по пассажиропотоку в Китае. Длина взлетно-посадочной полосы — 1097 м.

Контакты:

Обратите внимание! Официальный сайт на данный момент находится в разработке.

Третий крупнейший китайский аэропорт Сиань находится в 15 км от города Сяньян и в 30 км от Сианя. Имеет две взлетно-посадочные полосы.

Контакты:

  • Адрес: Xianyang, Xi´an 712035, Shanxi.
  • Код ИКАО: ZLXY.
  • Код ИАТА: XIY.
  • Режим работы: круглосуточно.
  • Сайт аэропорта XIY: http://www.xxia.com.
  • Телефон: +86 (0)29 88375000.

Онлайн-табло рейсов

Следить за расписанием рейсов китайских аэропортов сложно: официальные сайты есть не у всех аэроузлов, версий на русском языке нет. Можно воспользоваться специальными ресурсами, например, https://rasp.yandex.ru, где в онлайн-режиме доступна информация по вылетам и прилётам.

Онлайн-табло аэропорта Ухань: https://rasp.yandex.ru/station/9626531/

Онлайн-табло аэропорта Ченгду: https://rasp.yandex.ru/station/9632067/

Онлайн-табло аэропорта Сиань: https://rasp.yandex.ru/station/9631698

Обратите внимание! Время вылета и прилёта всегда указывается в местном часовом поясе.

Онлайн-табло также позволяет отследить все задержанные и отложенные рейсы.

Как добраться

От аэровокзала Ухань до города можно добраться на:

  • Wuhan Metro. Ехать примерно 36 мин.
  • Автобусах № 17 или 32. Ехать примерно 40 мин.
  • Такси или частном трансфере.

Дополнительная информация! Аэропорт состоит из двух терминалов, сейчас* строится третий, после его открытия планируется запустить железнодорожное сообщение прямо к аэровокзалу.

От Чэнду до города доехать можно на:

  • Автобусах 1, 2, 3 и 4.
  • Скором поезде, который связывает аэровокзал с Южной и Восточной станциями.

Ченду

Из Сиань в город можно попасть на:

  • Автобусах: комфортные шаттлы довезут до города примерно за час.
  • Такси. Тарифы не установлены точно, но поездка выйдет не меньше 100 юаней*.

Парковки

Возле аэропорта Ухань имеется кратковременная бесплатная парковка, есть также долговременная платная, 1 час стоит примерно 3–4 $*.

Возле Чэнду есть две парковки, принимают только юани, 1 час стоит около 10 юаней.* Одна стоянка предназначена для больших машин, другая — для маленьких, поэтому цена может зависеть от размера автомобиля.

Возле аэроузла Сиань имеется большая парковка, где 15 минут стоянки бесплатные, сутки — около 100 юаней.* Кроме того, недалеко имеется городская парковка, где цены ниже.

Схемы аэропортов

Аэропорт Ухань площадью в 121000 м² имеет два терминала, одну взлетно-посадочную полосу, покрытую бетоном. В терминалах имеются места для курения, банкоматы, бюро находок, медицинский центр, аптеки, пункты обмена валют. Соединен с городом метро и скоростными трассами S18 и S19.

Шуанлю состоит из двух терминалов, в них есть залы ожидания бизнес-класса, пункты обмена денег, бюро находок и другие сервисы.

Сиань открылся в 1991 году, имеет два терминала, в каждом есть кафе, магазины, медицинский центр, банкоматы и полиция.

Во всех терминалах есть указатели, часто их дублируют на английском языке.

Аэропорт Сиань в Китае

Услуги и Wi-Fi

В каждом аэропорту имеется свободный доступ к Wi-Fi, но, возможно, он будет работать не во всех залах. Также везде можно попросить у сотрудников багажные тележки.

Аэрокомплекс Ухань предлагает пассажирам 4 ресторана, бар, кафе и конференц-зал. На втором этаже расположены камеры хранения, комната матери и ребенка.

Китайский Чэнду оснащен ресторанами, камерами хранения, имеется места для подзарядки телефонов.

Сиань также может похвастаться магазинами, где продают не только еду, но и одежду. Тут есть залы ожидания бизнес-класса, медицинские центры и рестораны.

Отели в транзитной зоне

В каждом из трех аэровокзалов есть комнаты отдыха, в том числе и люкс-комнаты.

Переночевать возле аэропорта Ухань можно в Carton Hote, Wuhan Minghang Guesthouse, чуть дальше находится City Comfort Inn Panlong City.

Аэропорт Ухань

В Чэнду тоже есть комнаты отдыха, недалеко от аэроузла находится отель Chuan Gang International, а Chengdu Airport предложит ещё и услуги спа-комплекса. Бюджетный вариант — Chengdu Shuangliu Datong Shiji.

Сиань имеет комнаты для отдыха, до ближайшего отеля вне аэрокомплекса — 6 км.

Какие авиакомпании летают

Все три аэропорта — это крупнейшие транспортные узлы Китая, сюда летают такие авиакомпании, как:

  • China Southern Airlines;
  • Air China;
  • Air France;
  • KLM;
  • THAI;
  • SAS;
  • Xiamen Airlines Company;
  • United Airlines;
  • AirAsia и др.

Маршруты с Россией

Маршруты из России часто выполняются из Москвы, Новосибирска, Тюмени, Владивостока. Многие летят в Пекин, аэропорт Циндао Куаньдян (код аэропорта — TAO), Шанхай, Гонконг на остров Хайнань в Санья и другие города, названия которых иногда сложно выговорить.

В Ухань рейсы выполняются из Москвы, имеются прямые перелёты, осуществляемые Аэрофлотом и China Southern Airlines, есть с пересадкой в Пекине или Урумчи.

В Чэнду летает прямой рейс из Санкт-Петербурга авиакомпанией Sichuan Airlines, из Москвы — с пересадками.

В Сиань из России можно попасть из Владивостока с пересадкой в других городах Китая, из Москвы тоже только с пересадками.

Китай может предложить туристам как познавательный, так и пляжный отдых, поэтому неудивительно, что пассажиропоток большой: в 2017 г. сертифицированные аэродромы КНР приняли 552 млн человек. Уже к 2022 г. Китай может стать крупнейшим рынком гражданской авиации.

*Информация и цены актуальны на май 2018 г.

В Шереметьево в пятницу ждут рейс из китайского Уханя, изолированного из-за коронавируса

Самолет из китайского Уханя, где произошла вспышка нового коронавируса, ждут в Москве в пятницу вечером.

Как следует из онлайн-табло аэропорта Шереметьево, прямой рейс авиакомпании China Southern из аэропорта Тяньхэ, обслуживающего Ухань, приземлится в Шереметьево в 19:25 мск пятницы.

Тем временем, накануне с задержкой в 14 минут в 21:54 мск из Шереметьево туда вылетел рейс той же авиакомпании.

Из Москвы в Ухань прямой рейс выполняет китайская компания China Southern. Далее после посадки в Ухани самолет летит в Гуанчжоу. Рейс выполняется из Шереметьево по средам, пятницам и воскресеньям.

Накануне штаб по профилактике и контролю эпидемии, расположенный в Ухани, сообщил об остановке работы с утра четверга автобусов, метро и паромов. Жителей призвали без особой необходимости не покидать город. Также введены временные ограничения на коридоры выездов в аэропорту и железнодорожных станциях города.

Между тем, как сообщил «Интерфаксу» информированный источник, «в Москве не получали сведений о закрытии аэропорта».

«NOTAM о закрытии аэропорта не поступал. Российские авиавласти не вводили ограничений на полеты в Ухань. Рейсы выполняются по расписанию», — сказал собеседник агентства.

Как следует из онлайн-табло аэропорта Тяньхэ на сервисе Flightradar24, он полностью не закрыт на вылет и прилет и отчасти продолжает работу, хотя большая часть рейсов на вылет и прилет отменена. Однако, по данным Flightradar24, чуть более часа назад там приземлился борт AirChina из Урумчи, 75 минут назад — самолет China Eastern из Токио.

Московский рейс CZ355 также значится как готовящийся к вылету по расписанию. Статус «отменен» рейсу не присвоен.

Накануне информированный источник сообщил «Интерфаксу», что с российской стороны никаких ограничений на полеты в Ухань нет. Тем не менее, по его словам, не исключены переносы рейсов по инициативе китайской стороны. «Если авиаперевозчик физически не сможет выполнить рейс, например, в связи с закрытием аэропорта или введением запрета от местных властей, тогда возможны изменения в расписании. Информация должна быть доведена до пассажиров заранее», — сказал источник.

Вспышка пневмонии в Ухане была зафиксирована в декабре, возбудителем стал ранее неизвестный коронавирус 2019-nCoV, геном вируса уже расшифрован и опубликован. По последним данным, более 630 человек заразились вирусом, 17 человек погибли. Кроме того, случаи заболевания зафиксированы в Таиланде, в Японии, Южной Корее, США, Гонконге, Тайване, Макао.

В четверг стало известно, что в Китае изолировали уже два города в рамках борьбы с распространением коронавируса — Хуанган и Ухань.

Авторские права на данный материал принадлежат информационному агентству «Интерфакс — Туризм». Цель включения данного материала в дайджест — сбор максимального количества публикаций в СМИ и сообщений компаний по авиационной тематике. Агентство «АвиаПорт» не гарантирует достоверность, точность, полноту и качество данного материала.

онлайн табло прилета на сегодня – LowCost.Club

воскресенье, 20 марта
00:05DR5039Куньмин (Куньмин) Ruili Airlines733По расписанию
00:059C8919Ханчжоу (Ханчжоу) Spring Airlines320По расписанию
00:109C6174Чанчжоу (Чанчжоу) Spring AirlinesA320 (Airbus A320-214)По расписанию
00:10MU5603Шанхай (Пудун) China Eastern Airlines320По расписанию
00:15OQ2028Хайлар (Хайлар) Chongqing Airlines320По расписанию
00:15CF9028Нанкин (Нанкин) China Postal Airlines73FПо расписанию
00:20CZ5872Санья (Санья) China Southern Airlines320По расписанию
00:20SC8009Сямынь (Сямынь) Shandong Airlines738По расписанию
00:20CZ6302Гуанчжоу (Байюн) China Southern Airlines320По расписанию
00:25ZH9724Вэньчжоу (Вэньчжоу) Shenzhen AirlinesA320 (Airbus A320-232)По расписанию
00:25CZ6508Шанхай (Пудун) China Southern Airlines321По расписанию
00:30CZ6302Гуанчжоу (Байюн) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
00:35CZ6508Шанхай (Пудун) China Southern Airlines320По расписанию
00:409C6900Цзинань (Цзинань) Spring AirlinesA320 (Airbus A320-214)По расписанию
00:40MU6499Сиань (Сиань) China Eastern Airlines319По расписанию
00:45CZ6416Сиань (Сиань) China Southern Airlines320По расписанию
00:459C8924Наньчан (Наньчан) Spring Airlines320По расписанию
00:50DR6590Хайлар (Хайлар) Ruili Airlines733По расписанию
00:50CZ6304Шэньчжэнь (Шэньчжэнь) China Southern Airlines321По расписанию
01:20CZ6304Шэньчжэнь (Шэньчжэнь) China Southern Airlines320По расписанию
01:25CZ6380Чанша (Чанша) China Southern Airlines321По расписанию
01:30DR5022Хайлар (Хайлар) Ruili AirlinesB738 (Boeing 737-8JP)По расписанию
01:459C7026Ханьдань (Ханьдань) Spring Airlines320По расписанию
01:509C8926Лоян (Лоян) Spring AirlinesA320 (Airbus A320-214)По расписанию
07:15O36864Ханчжоу (Ханчжоу) SF AirlinesB763 (Boeing 767-304(ER)(BCF))По расписанию
08:15CF9028Нанкин (Нанкин) China Postal Airlines73FПо расписанию
08:25QW9779Циндао (Куаньдян) Qingdao Airlines320По расписанию
08:50SC2311Циндао (Куаньдян) Shandong Airlines738По расписанию
08:559C6334Чжэнчжоу (Чжэнчжоу) Spring AirlinesA320 (Airbus A320-214)По расписанию
08:559H8313Сиань (Сиань) Air Changan738По расписанию
08:55ZH8356Чжэнчжоу (Чжэнчжоу) Shenzhen Airlines738По расписанию
08:559C8839Шанхай (Пудун) Spring Airlines320По расписанию
09:209C8839Шанхай (Пудун) Spring Airlines320По расписанию
09:409C8638Нинбо (Нинбо) Spring Airlines320По расписанию
09:45MU2929Уси (Уси) China Eastern AirlinesA320 (Airbus A320-232)По расписанию
09:50FM9169Шанхай (Пудун) Shanghai Airlines738По расписанию
09:50MU2183Сиань (Сиань) China Eastern AirlinesA20N (Airbus A320-251N)По расписанию
09:50MU2929Уси (Уси) China Eastern Airlines320По расписанию
09:55TV9879Чэнду (Чэнду) Tibet Airlines320По расписанию
10:00SC7915Яньтай (Лайшань) Shandong Airlines738По расписанию
10:00A67199Нанкин (Нанкин) Air Travel319По расписанию
10:059C6334Чжэнчжоу (Чжэнчжоу) Spring Airlines320По расписанию
10:10HO1717Нанкин (Нанкин) Juneyao Airlines320По расписанию
10:10HO1181Шанхай (Пудун) Juneyao Airlines32AПо расписанию
10:203U8467Чэнду (Чэнду) Sichuan Airlines321По расписанию
10:25CA1651Пекин (Пекин) Air ChinaB738 (Boeing 737-89L)По расписанию
10:25ZH8351Чжэнчжоу (Чжэнчжоу) Shenzhen Airlines320По расписанию
10:30CZ6510Шанхай (Пудун) China Southern Airlines321По расписанию
10:30MF8049Ханчжоу (Ханчжоу) Xiamen Airlines738По расписанию
10:35ZH8351Чжэнчжоу (Чжэнчжоу) Shenzhen AirlinesB738 (Boeing 737-87L)По расписанию
10:35CA4175Куньмин (Куньмин) Air ChinaA20N (Airbus A320-271N)По расписанию
10:409C6520Ланьчжоу (Ланчжоу) Spring Airlines320По расписанию
10:55CZ6598Ухань (Ухань) China Southern Airlines320По расписанию
10:55CZ6510Шанхай (Пудун) China Southern Airlines321По расписанию
11:00ZH9704Нанкин (Нанкин) Shenzhen Airlines320По расписанию
11:05MF8049Ханчжоу (Ханчжоу) Xiamen AirlinesB738 (Boeing 737-85C)По расписанию
11:10MF8025Чанша (Чанша) Xiamen AirlinesB738 (Boeing 737-85C)По расписанию
11:15CA4061Куньмин (Куньмин) Air China320По расписанию
11:15FM9187Шанхай (Пудун) Shanghai Airlines738По расписанию
11:20CA4163Юньчэн (Юньчэн) Air China738По расписанию
11:25FM9187Шанхай (Пудун) Shanghai Airlines738По расписанию
11:25CZ8634Ханчжоу (Ханчжоу) China Southern Airlines320По расписанию
11:35CA4185Чэнду (Чэнду) Air ChinaA21N (Airbus A321-271N)По расписанию
11:35MU6339Шанхай (Хунцяо) China Eastern AirlinesA321 (Airbus A321-211)По расписанию
11:35MU5481Циндао (Куаньдян) China Eastern Airlines320По расписанию
11:40MU5481Циндао (Куаньдян) China Eastern Airlines320По расписанию
11:403U8849Тайюань (Тайюань) Sichuan Airlines320По расписанию
11:40BK2993Тайюань (Тайюань) Okay AirwaysB738 (Boeing 737-8FH)По расписанию
11:40MF8031Сямынь (Сямынь) Xiamen AirlinesB738 (Boeing 737-85C)По расписанию
11:40PN6247Рио Альзукар (Рио-Альцукар) West Air China320По расписанию
11:45CZ8788Гуанчжоу (Байюн) China Southern Airlines32QПо расписанию
11:45CZ8788Гуанчжоу (Байюн) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
11:45MU2545Яньчэн (Яньчэн) China Eastern Airlines73HПо расписанию
11:50AQ1059Чжэнчжоу (Чжэнчжоу) 9 Air738По расписанию
11:50HU7735Чжэнчжоу (Чжэнчжоу) Hainan Airlines738По расписанию
11:50MU2545Яньчэн (Яньчэн) China Eastern Airlines73HПо расписанию
11:55SC4907Чжэнчжоу (Чжэнчжоу) Shandong Airlines738По расписанию
12:00CZ6384Санья (Санья) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
12:00CZ8788Гуанчжоу (Байюн) China Southern Airlines32QПо расписанию
12:05ZH9601Шэньчжэнь (Шэньчжэнь) Shenzhen Airlines320По расписанию
12:05MU6347Шанхай (Хунцяо) China Eastern Airlines320По расписанию
12:15ZH9601Шэньчжэнь (Шэньчжэнь) Shenzhen Airlines738По расписанию
12:20MU7722Нанкин (Нанкин) China Eastern Airlines320По расписанию
12:20MU5466Шанхай (Пудун) China Eastern Airlines321По расписанию
12:25HU7697Тайюань (Тайюань) Hainan Airlines738По расписанию
12:30CZ6388Чжухай (Чжухай) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
12:35CZ3983Цзинань (Цзинань) China Southern Airlines320По расписанию
12:35RY8923Цзинань (Цзинань) Jiangxi Air738По расписанию
12:40MU5466Шанхай (Пудун) China Eastern AirlinesA20N (Airbus A320-251N)По расписанию
12:40HO1187Шанхай (Пудун) Juneyao Airlines32AПо расписанию
12:40CZ5816Чунцин (Чунцин) China Southern Airlines320По расписанию
12:45CZ5816Чунцин (Чунцин) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
12:459C8696Нинбо (Нинбо) Spring AirlinesA320 (Airbus A320-214)По расписанию
12:45ZH9273Линьи (Линьи) Shenzhen Airlines320По расписанию
12:50SC7683Шэньчжэнь (Шэньчжэнь) Shandong Airlines738По расписанию
12:50ZH9553Уси (Уси) Shenzhen Airlines320По расписанию
12:559C6628Хэфэй (Хэфэй) Spring Airlines320По расписанию
12:559C6628Хэфэй (Хэфэй) Spring AirlinesA320 (Airbus A320-214)По расписанию
12:55CZ5190Урумчи (Урумчи) China Southern Airlines320По расписанию
13:05CZ6332Гуанчжоу (Байюн) China Southern Airlines320По расписанию
13:05SC4840Циндао (Куаньдян) Shandong Airlines738По расписанию
13:10HO1923Нанкин (Нанкин) Juneyao Airlines32NПо расписанию
13:10EU2757Чэнду (Чэнду) Chengdu Airlines320По расписанию
13:10HO1183Шанхай (Пудун) Juneyao Airlines32AПо расписанию
13:15SC4907Чжэнчжоу (Чжэнчжоу) Shandong Airlines738По расписанию
13:209C8832Сиань (Сиань) Spring Airlines320По расписанию
13:20CZ3611Шэньчжэнь (Шэньчжэнь) China Southern Airlines321По расписанию
13:309C8919Ханчжоу (Ханчжоу) Spring AirlinesA320 (Airbus A320-214)По расписанию
13:35MF8087Ханчжоу (Ханчжоу) Xiamen AirlinesB738 (Boeing 737-85C)По расписанию
13:403U8293Сюйчжоу (Сюйчжоу) Sichuan Airlines32NПо расписанию
13:403U8293Сюйчжоу (Сюйчжоу) Sichuan Airlines320По расписанию
13:45CZ3655Нанкин (Нанкин) China Southern Airlines738По расписанию
13:50ZH9655Цюаньчжоу (Цюаньчжоу) Shenzhen Airlines320По расписанию
13:50ZH9784Тайчжоу (Хуанъянь) Shenzhen Airlines738По расписанию
13:50DR5017Хух-Хото (Хух-Хото) Ruili Airlines737По расписанию
13:55ZH9736Юньчэн (Юньчэн) Shenzhen AirlinesA320 (Airbus A320-232)По расписанию
13:55ZH9603Шэньчжэнь (Шэньчжэнь) Shenzhen AirlinesA320 (Airbus A320-214)По расписанию
13:559C7168Чанша (Чанша) Spring AirlinesA320 (Airbus A320-214)По расписанию
13:55MF8087Ханчжоу (Ханчжоу) Xiamen Airlines738По расписанию
14:00HU7047Сямынь (Сямынь) Hainan Airlines738По расписанию
14:05CZ6761Санья (Санья) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
14:059C6759Шанхай (Пудун) Spring Airlines320По расписанию
14:10CZ6316Гуанчжоу (Байюн) China Southern Airlines320По расписанию
14:15CZ3611Шэньчжэнь (Шэньчжэнь) China Southern AirlinesA320 (Airbus A320-232)По расписанию
14:15CZ8664Нинбо (Нинбо) China Southern Airlines320По расписанию
14:20CZ6361Гуйлинь (Гуйлинь) China Southern Airlines738По расписанию
14:25CA1657Пекин (Пекин) Air China321По расписанию
14:25MU9949Шанхай (Пудун) China Eastern AirlinesA20N (Airbus A320-251N)По расписанию
14:25CZ6504Шанхай (Пудун) China Southern Airlines321По расписанию
14:25CZ6496Баотоу (Баотоу) China Southern Airlines320По расписанию
14:30CZ682Сеул (Инчеон) China Southern AirlinesA333 (Airbus A330-343)По расписанию
14:30MU6383Иньчуань (Иньчуань) China Eastern AirlinesA320 (Airbus A320-232)По расписанию
14:35CZ6504Шанхай (Пудун) China Southern Airlines321По расписанию
14:35SC8831Яньтай (Лайшань) Shandong Airlines738По расписанию
14:35CZ6230Ханчжоу (Ханчжоу) China Southern Airlines321По расписанию
14:40ZH9603Шэньчжэнь (Шэньчжэнь) Shenzhen Airlines320По расписанию
14:45CZ6603Чжэнчжоу (Чжэнчжоу) China Southern Airlines321По расписанию
15:00HU7667Ухань (Ухань) Hainan Airlines738По расписанию
15:00CZ6230Ханчжоу (Ханчжоу) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
15:00ZH9651Чанчжоу (Чанчжоу) Shenzhen AirlinesA20N (Airbus A320-271N)По расписанию
15:00CZ6520Ухань (Ухань) China Southern Airlines320По расписанию
15:05SC4725Циндао (Куаньдян) Shandong AirlinesB738 (Boeing 737-85N)По расписанию
15:05CZ6414Сиань (Сиань) China Southern Airlines320По расписанию
15:15MU2927Чанчжоу (Чанчжоу) China Eastern Airlines320По расписанию
15:153U3507Сиань (Сиань) Sichuan Airlines32NПо расписанию
15:153U8563Тайюань (Тайюань) Sichuan Airlines32BПо расписанию
15:20JD5669Хуаншань (Тунси) Capital AirlinesA320 (Airbus A320-214)По расписанию
15:20ZH8308Сянфань (Сянфань) Shenzhen AirlinesA320 (Airbus A320-214)По расписанию
15:20CZ6559Хайкоу (Хайкоу) China Southern Airlines320По расписанию
15:30MU2263Сиань (Сиань) China Eastern Airlines737По расписанию
15:35SC8411Цзинань (Цзинань) Shandong AirlinesB738 (Boeing 737-85N)По расписанию
15:35CZ6506Шанхай (Пудун) China Southern Airlines320По расписанию
15:45CZ6506Шанхай (Пудун) China Southern AirlinesB789 (Boeing 787-9 Dreamliner)По расписанию
15:459C8849Шанхай (Пудун) Spring AirlinesA320 (Airbus A320-214)По расписанию
15:45ZH9731Наньтун (Наньтун) Shenzhen AirlinesB738 (Boeing 737-87L)По расписанию
15:55CZ6559Хайкоу (Хайкоу) China Southern Airlines320По расписанию
16:00HO1187Шанхай (Пудун) Juneyao Airlines32AПо расписанию
16:05HU7821Цзинань (Цзинань) Hainan Airlines738По расписанию
16:15CZ8522Иу (Иу) China Southern Airlines738По расписанию
16:15FM9189Шанхай (Пудун) Shanghai Airlines73EПо расписанию
16:15NS3241Шицзячжуан (Дагуокан) Hebei Airlines738По расписанию
16:20JD5617Фучжоу (Фучжоу) Capital AirlinesA320 (Airbus A320-214)По расписанию
16:25FM9189Шанхай (Пудун) Shanghai Airlines738По расписанию
16:30ZH9710Хэфэй (Хэфэй) Shenzhen AirlinesB738 (Boeing 737-87L)По расписанию
16:353U8563Тайюань (Тайюань) Sichuan Airlines320По расписанию
16:35HU6201Хайкоу (Хайкоу) Hainan AirlinesB738 (Boeing 737-84P)По расписанию
16:40CZ6402Чэнду (Чэнду) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
16:45JD5627Ухань (Ухань) Capital Airlines320По расписанию
16:45MF8771Циндао (Куаньдян) Xiamen Airlines738По расписанию
16:509C8554Ланьчжоу (Ланчжоу) Spring AirlinesA320 (Airbus A320-214)По расписанию
16:50ZH8915Вэньчжоу (Вэньчжоу) Shenzhen Airlines320По расписанию
16:55CZ6408Чанша (Чанша) China Southern Airlines320По расписанию
16:55CZ6340Гуанчжоу (Байюн) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
17:003U6417Ордос (Дуншэн) Sichuan Airlines32BПо расписанию
17:05EU1839Чанша (Чанша) Chengdu Airlines320По расписанию
17:05CZ6383Цзиси (Цзиси) China Southern Airlines320По расписанию
17:10FU6625Линьи (Линьи) Fuzhou AirlinesB738 (Boeing 737-84P)По расписанию
17:15MU5607Шанхай (Пудун) China Eastern Airlines32SПо расписанию
17:15AQ1071Уси (Уси) 9 Air738По расписанию
17:15SC4715Циндао (Куаньдян) Shandong Airlines738По расписанию
17:15CZ6518Сямынь (Сямынь) China Southern Airlines320По расписанию
17:20MU5607Шанхай (Пудун) China Eastern Airlines321По расписанию
17:25MF8059Ханчжоу (Ханчжоу) Xiamen Airlines738По расписанию
17:25HO1183Шанхай (Пудун) Juneyao AirlinesA20N (Airbus A320-271N)По расписанию
17:35MU2757Нанкин (Нанкин) China Eastern AirlinesA320 (Airbus A320-232)По расписанию
17:353U6417Ордос (Дуншэн) Sichuan Airlines320По расписанию
17:35HO1717Нанкин (Нанкин) Juneyao Airlines320По расписанию
17:40SC8419Тайюань (Тайюань) Shandong Airlines738По расписанию
17:45CA8247Ухань (Ухань) Air China320По расписанию
17:50MF8059Ханчжоу (Ханчжоу) Xiamen Airlines738По расписанию
17:55MF8077Нанкин (Нанкин) Xiamen Airlines738По расписанию
18:00ZH9605Шэньчжэнь (Шэньчжэнь) Shenzhen Airlines319По расписанию
18:10HO1188Хайлар (Хайлар) Juneyao Airlines320По расписанию
18:15ZH9655Чанчжоу (Чанчжоу) Shenzhen Airlines320По расписанию
18:25CZ6331Ичунь (Ичунь) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
18:25MF8077Нанкин (Нанкин) Xiamen Airlines738По расписанию
18:30CZ6516Шанхай (Пудун) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
18:30MF8069Ляньюньган (Ляньюньган) Xiamen Airlines738По расписанию
18:30FM9185Шанхай (Хунцяо) Shanghai Airlines737По расписанию
18:35GJ8695Вэйхай (Вэйхай) Loong Airlines320По расписанию
18:35CZ5860Хух-Хото (Хух-Хото) China Southern Airlines320По расписанию
18:35JD5785Шицзячжуан (Дагуокан) Capital Airlines320По расписанию
18:40FM9185Шанхай (Хунцяо) Shanghai AirlinesB738 (Boeing 737-89P)По расписанию
18:40CZ6516Шанхай (Пудун) China Southern Airlines321По расписанию
18:55ZH9605Шэньчжэнь (Шэньчжэнь) Shenzhen Airlines320По расписанию
18:55CZ6368Гуанчжоу (Байюн) China Southern Airlines320По расписанию
19:05HU7203Вэйфан (Вэйфан) Hainan AirlinesB738 (Boeing 737-84P)По расписанию
19:05JD5785Шицзячжуан (Дагуокан) Capital Airlines320По расписанию
19:05EU2209Баотоу (Баотоу) Chengdu AirlinesA320 (Airbus A320-214)По расписанию
19:05G56283Баотоу (Баотоу) China Express AirlinesCR9По расписанию
19:15CZ3612Дацин (Дацин) China Southern Airlines321По расписанию
19:25CZ6368Гуанчжоу (Байюн) China Southern Airlines320По расписанию
19:30CZ6386Хэфэй (Хэфэй) China Southern Airlines320По расписанию
19:303U8611Сиань (Сиань) Sichuan Airlines319По расписанию
19:35CZ8719Чжэнчжоу (Чжэнчжоу) China Southern Airlines73GПо расписанию
19:40CZ8626Сямынь (Сямынь) China Southern Airlines320По расписанию
19:45CA8315Шанхай (Пудун) Air China321По расписанию
19:45CZ6664Чунцин (Чунцин) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
19:45G56795Чунцин (Чунцин) China Express AirlinesCR9По расписанию
19:55CA8315Шанхай (Пудун) Air China321По расписанию
20:00MU9779Нанкин (Нанкин) China Eastern Airlines320По расписанию
20:05CA1635Пекин (Пекин) Air China333По расписанию
20:10ZH9708Тайюань (Тайюань) Shenzhen Airlines738По расписанию
20:10MU6658Хэфэй (Хэфэй) China Eastern Airlines320По расписанию
20:159C6552Янчжоу (Янчжоу) Spring AirlinesA320 (Airbus A320-214)По расписанию
20:159C6200Чжэнчжоу (Чжэнчжоу) Spring AirlinesA20N (Airbus A320-251N)По расписанию
20:15CA1635Пекин (Пекин) Air China321По расписанию
20:20CZ6312Рио Альзукар (Рио-Альцукар) China Southern Airlines320По расписанию
20:25ZH9738Датун (Датун) Shenzhen Airlines320По расписанию
20:30CZ5934Санья (Санья) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
20:40CZ6348Гуанчжоу (Байюн) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
20:40CZ6312Циндао (Куаньдян) China Southern Airlines320По расписанию
20:45CZ6727Чанша (Чанша) China Southern AirlinesA320 (Airbus A320-232)По расписанию
20:50MF8095Шанхай (Пудун) Xiamen Airlines738По расписанию
20:50CZ6348Гуанчжоу (Байюн) China Southern Airlines320По расписанию
20:55HO1181Шанхай (Пудун) Juneyao Airlines320По расписанию
20:55CZ6452Нанкин (Нанкин) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
20:55GJ8638Цзиань (Цзиань) Loong Airlines320По расписанию
21:05MU6619Яньтай (Лайшань) China Eastern AirlinesA320 (Airbus A320-214)По расписанию
21:20QW6016Наньтун (Наньтун) Qingdao Airlines320По расписанию
21:20CZ6502Шанхай (Пудун) China Southern Airlines320По расписанию
21:20CZ6310Шэньчжэнь (Шэньчжэнь) China Southern Airlines320По расписанию
21:25EU1858Ухань (Ухань) Chengdu Airlines320По расписанию
21:30GJ8865Ханчжоу (Ханчжоу) Loong Airlines320По расписанию
21:30SC7922Цзинань (Цзинань) Shandong Airlines738По расписанию
21:35CA1601Пекин (Пекин) Air China320По расписанию
21:459C8660Шицзячжуан (Дагуокан) Spring AirlinesA320 (Airbus A320-214)По расписанию
21:45ZH9716Линьи (Линьи) Shenzhen AirlinesA20N (Airbus A320-271N)По расписанию
21:45CZ6502Шанхай (Пудун) China Southern AirlinesA333 (Airbus A330-343)По расписанию
21:45CA1601Пекин (Пекин) Air China321По расписанию
21:509C6702Яньчэн (Яньчэн) Spring Airlines320По расписанию
22:00JD5503Цзинань (Цзинань) Capital Airlines320По расписанию
22:00CZ6288Ханчжоу (Ханчжоу) China Southern Airlines321По расписанию
22:00SC4846Яньтай (Лайшань) Shandong Airlines738По расписанию
22:05EU1847Люйлян (Люйлян) Chengdu Airlines320По расписанию
22:05MU6452Наньчан (Наньчан) China Eastern Airlines320По расписанию
22:10ZH9730Наньтун (Наньтун) Shenzhen AirlinesA320 (Airbus A320-232)По расписанию
22:10ZH8369Чжэнчжоу (Чжэнчжоу) Shenzhen Airlines738По расписанию
22:15EU2769Чжэнчжоу (Чжэнчжоу) Chengdu Airlines320По расписанию
22:15CZ8472Чэнду (Чэнду) China Southern Airlines320По расписанию
22:20EU2755Ляньюньган (Ляньюньган) Chengdu Airlines320По расписанию
22:20MU6452Наньчан (Наньчан) China Eastern AirlinesA320 (Airbus A320-214)По расписанию
22:30CZ6582Нанкин (Нанкин) China Southern Airlines320По расписанию
22:35CZ6288Ханчжоу (Ханчжоу) China Southern Airlines321По расписанию
22:35MF8846Фучжоу (Фучжоу) Xiamen Airlines738По расписанию
22:35ZH9369Ухань (Ухань) Shenzhen Airlines320По расписанию
22:40ZH9706Нанкин (Нанкин) Shenzhen Airlines738По расписанию
22:45ZH9657Яньтай (Лайшань) Shenzhen Airlines320По расписанию
22:45EU2766Ляньюньган (Ляньюньган) Chengdu Airlines320По расписанию
22:50JD5584Ухань (Ухань) Capital Airlines320По расписанию
22:50GJ8865Ханчжоу (Ханчжоу) Loong Airlines320По расписанию
22:50ZH9657Яньтай (Лайшань) Shenzhen Airlines320По расписанию
22:55CZ6310Рио Альзукар (Рио-Альцукар) China Southern Airlines320По расписанию
22:55DR6586Таншань (Таншань) Ruili Airlines733По расписанию
23:00ZH9553Уси (Уси) Shenzhen AirlinesA20N (Airbus A320-271N)По расписанию
23:00G56363Сиань (Сиань) China Express AirlinesCR9По расписанию
23:00CZ6456Сиань (Сиань) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
23:00JD5826Шицзячжуан (Дагуокан) Capital Airlines320По расписанию
23:10RY6656Шэньчжэнь (Шэньчжэнь) Jiangxi Air738По расписанию
23:10CZ3601Гуанчжоу (Байюн) China Southern Airlines320По расписанию
23:15CA1087Чанчунь (Чанчунь) Air ChinaB752 (Boeing 757-2Z0(PCF))По расписанию
23:15O36864Ханчжоу (Ханчжоу) SF AirlinesB752 (Boeing 757-236(PCF))По расписанию
23:15O36864Ханчжоу (Ханчжоу) SF AirlinesB763 (Boeing 767-375(ER)(BCF))По расписанию
23:15ZH9728Чжэнчжоу (Чжэнчжоу) Shenzhen Airlines320По расписанию
23:15RY6656Шэньчжэнь (Шэньчжэнь) Jiangxi Air738По расписанию
23:20ZH9728Чжэнчжоу (Чжэнчжоу) Shenzhen Airlines320По расписанию
23:20G56162Чжэнчжоу (Чжэнчжоу) China Express AirlinesCR9По расписанию
23:25CZ3601Гуанчжоу (Байюн) China Southern AirlinesA20N (Airbus A320-271N)По расписанию
23:25CZ6492Ланьчжоу (Ланчжоу) China Southern Airlines320По расписанию
23:25CZ6725Чжэнчжоу (Чжэнчжоу) China Southern Airlines321По расписанию
23:35ZH9609Янчжоу (Янчжоу) Shenzhen Airlines320По расписанию
23:35EU2714Хэфэй (Хэфэй) Chengdu Airlines320По расписанию
23:35G56886Янчжоу (Янчжоу) China Express AirlinesCR9По расписанию
23:35CZ6404Чунцин (Чунцин) China Southern AirlinesA20N (Airbus A320-251N)По расписанию
23:35G56921Чунцин (Чунцин) China Express AirlinesCR9По расписанию
23:40CZ8634Ханчжоу (Ханчжоу) China Southern AirlinesA320 (Airbus A320-214)По расписанию
23:45QW6026Вэньчжоу (Вэньчжоу) Qingdao Airlines32NПо расписанию
23:509C8744Вэйхай (Вэйхай) Spring Airlines320По расписанию
23:50MU5603Шанхай (Пудун) China Eastern AirlinesA320 (Airbus A320-214)По расписанию

клинических характеристик 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 года, в Ухане, Китай | Медицина интенсивной терапии | ДЖАМА

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 года (NCIP), в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов нуждались в госпитализации в отделение интенсивной терапии и 4.3% умерли. Предполагаемая внутрибольничная передача 2019-nCoV от человека к человеку была заподозрена у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой внутрибольничной передачей, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличилось, но информация о клинических характеристиках пораженных пациентов ограничена.

Цель Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, сеттинг и участники Ретроспективная одноцентровая серия случаев из 138 последовательно госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения — 3 февраля 2020 г.

Воздействие Документированный НКИП.

Основные результаты и показатели Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, рентгенологические данные и данные о лечении. Исходы пациентов в критическом состоянии и пациентов в некритическом состоянии сравнивались. Предполагаемая внутрибольничная передача подозревалась, если заражалась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах и ​​можно было отследить возможный источник инфекции.

Результаты Среди 138 госпитализированных пациентов с NCIP средний возраст составил 56 лет (межквартильный диапазон 42-68 лет, диапазон 22-92 года), 75 (54,3%) были мужчинами. Внутрибольничная передача подозревалась как предполагаемый механизм заражения пострадавших медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали лихорадку (136 [98,6%]), утомляемость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов, 0,8 × 10 9 /л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), удлинение протромбинового времени (13,0 секунд [МКИ, 12,3-13,7]) у 80 пациентов (58%) и повышение уровня лактатдегидрогеназы (261 Ед/л [МКИ, 182-182%). 403]) у 55 больных (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или непрозрачность по типу «матового стекла» в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18.4%].1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение реанимации и интенсивной терапии (ОИТ) из-за осложнений, в том числе острого респираторного дистресс-синдрома (22 [61,1%]), аритмии (16 [44,4%]) и шока (11 [30,6%]). %]). Среднее время от первого симптома до появления одышки составило 5,0 дней, до госпитализации — 7,0 дней, до ОРДС — 8,0 дней. Пациенты, получавшие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не получавшими лечения в отделении интенсивной терапии (n = 102), были старше (медиана возраста 66 лет против 51 года), чаще имели сопутствующие заболевания (26 [72.2%] по сравнению с 38 [37,3%]), и чаще страдали одышкой (23 [63,9%] по сравнению с 20 [19,6%]) и анорексией (24 [66,7%] по сравнению с 31 [30,4%]). Из 36 больных в ОИТ 4 (11,1%) получали высокопотоковую оксигенотерапию, 15 (41,7%) — неинвазивную вентиляцию легких, 17 (47,2%) — инвазивную вентиляцию легких (4 переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля выписано 47 пациентов (34,1%), умерло 6 (общая летальность 4,3%), но остальные пациенты остаются на стационарном лечении. Среди выписанных живыми (n = 47) медиана пребывания в стационаре составила 10 дней (IQR, 7.0-14,0).

Выводы и актуальность В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая внутрибольничная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref IDВ декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, теперь известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 г. в Китае было подтверждено в общей сложности 9692 случая NCIP. На международном уровне случаи были зарегистрированы в 24 странах и на 5 континентах. 6 3 января 2020 г. новый коронавирус 2019 г. (2019-nCoV) был обнаружен в образцах жидкости бронхоальвеолярного лаважа у пациента в Ухане и подтвержден как причина NCIP. 7 Полное секвенирование генома и филогенетический анализ показали, что 2019-nCoV является кладой, отличной от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (ТОРС) и ближневосточным респираторным синдромом (БВРС) человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и относится к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что распространение среди людей произошло в результате передачи от диких животных, незаконно проданных на оптовом рынке морепродуктов Хуанань. 8

Huang et al 9 впервые сообщили о 41 случае NCIP, в которых большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Huanan.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальный или сниженный уровень лейкоцитов и рентгенологические признаки пневмонии. Органная дисфункция (например, шок, острый респираторный дистресс-синдром [ОРДС], острая сердечная недостаточность и острая почечная недостаточность) и смерть могут наступить в тяжелых случаях. 9 Впоследствии Chen et al 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. и может привести к ОРДС.Однако о разнице в клинических характеристиках между тяжелыми и нетяжелыми случаями не сообщалось. Сообщения о случаях заболевания подтвердили передачу NCIP от человека к человеку. 10 ,11 В настоящее время не существует эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ОИТ), с нетяжелыми случаями, которые не получали помощь в ОИТ.

Дизайн исследования и участники

Quiz Ref IDЭта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). В исследование были включены все последовательные пациенты с подтвержденным NCIP, поступившие в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 года.От пациентов было получено устное согласие. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из крупнейших третичных учебных больниц и отвечает за лечение NCIP, назначенное правительством. Все пациенты с NCIP, включенные в это исследование, были диагностированы в соответствии с временным руководством Всемирной организации здравоохранения. 12 Клинические исходы (например, выписка, смертность, продолжительность пребывания в стационаре) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения интенсивной терапии больницы Чжуннань Уханьского университета. Эпидемиологические, клинико-лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм сбора данных из электронных медицинских карт. Данные были проверены обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, основные сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, терапию кортикостероидами, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, КТ грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острое повреждение почек было выявлено в соответствии с определением болезни почек: улучшение глобальных результатов. 14 Сердечная травма определялась, если сывороточные уровни сердечных биомаркеров (например, тропонина I) превышали верхний референтный предел 99-го процентиля или при электрокардиографии и эхокардиографии обнаруживались новые отклонения. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического состояния здоровья II. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и госпитализации в ОИТ.

Подозрение на внутрибольничную передачу возникало, если группа медицинских работников или госпитализированных пациентов в одних и тех же отделениях заражалась в течение определенного периода времени и можно было отследить возможный источник инфекции.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образца мазка из горла для выделения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора со 150 мкл раствора для сохранения вируса, и тотальную РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторных образцов (Чжунчжи, Ухань, Китай).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим встряхиванием в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об/мин в течение 5 минут. Суспензию использовали для анализа полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) в реальном времени РНК 2019-nCoV. Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и нуклеокапсидный белок (N), одновременно амплифицировали и тестировали в ходе анализа ОТ-ПЦР в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Анализ ОТ-ПЦР в реальном времени проводили с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров Probe, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ ОТ-ПЦР проводили в следующих условиях: инкубация при 50 °С в течение 15 минут и при 95 °С в течение 5 минут, 40 циклов денатурации при 94 °С в течение 15 секунд, удлинение и сбор сигнала флуоресценции при 55 °С в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 определялось как положительный результат теста, а значение Ct 40 или более определялось как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частоты и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианы и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием независимых групповых тестов t , когда данные были нормально распределены; в противном случае использовался критерий Манна-Уитни.Данные (ненормальное распределение) повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Доли категориальных переменных сравнивались с использованием критерия χ 2 , хотя при ограниченности данных использовался точный критерий Фишера. Все статистические анализы проводились с использованием программного обеспечения SPSS (Statistical Package for the Social Sciences) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двустороннее значение α менее 0,05 считалось статистически значимым. Анализы не были скорректированы для множественных сравнений, и, учитывая возможность ошибки I рода, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

Исследуемая популяция включала 138 госпитализированных пациентов с подтвержденным NCIP. Медиана возраста составила 56 лет (МКР 42-68 лет, диапазон 22-92 года), 75 (54,3%) мужчин. Из них 102 (73,9%) больных были госпитализированы в изолятор, а 36 (26.1%) были госпитализированы и переведены в ОРИТ в связи с развитием органной дисфункции (табл. 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составила 5 дней (IQR, 1–10), 7 дней (IQR, 4–8) и 8 дней (IQR, 6–12) соответственно (таблица 1). ). Из 138 пациентов 64 (46,4%) имели 1 или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее распространенными сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), утомляемость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (таблица 1). В общей сложности у 14 пациентов (10,1 %) первоначально развились диарея и тошнота за 1–2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощь в отделении интенсивной терапии (n = 102), пациенты, нуждавшиеся в помощи в отделении интенсивной терапии (n = 36), были значительно старше (медиана возраста 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37-78]. 62]; P  < .001) и чаще имели сопутствующие заболевания, включая гипертонию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%]), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярные заболевания (6 [16,7%] против 1 [1,0%]). боль и анорексия

Показатели жизнедеятельности и лабораторные параметры в ОИТ и у пациентов, не находящихся в ОИТ

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не отличались между пациентами, получавшими помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в стационар для всех пациентов, затем разделялись на тех, кто впоследствии был госпитализирован в ОИТ или нет. Были многочисленные различия в лабораторных данных между пациентами, поступившими в отделение интенсивной терапии, и пациентами, не госпитализированными в отделение интенсивной терапии (таблица 2), включая более высокое количество лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 зарегистрированных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до госпитализации в ОИТ составило 10 дней (межквартильный интервал 6–12) (таблица 3).Медиана шкалы комы Глазго в день поступления в отделение интенсивной терапии; Острая физиология и оценка хронического состояния здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9–15), 17 (IQR, 10–22) и 5 ​​(IQR, 3–6) соответственно (таблица 3). Среднее значение парциального давления кислорода составило 68 мм рт. ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составила 136 мм рт. ст. (IQR, 103–234).

Органные дисфункции и основные вмешательства

Органная дисфункция и лечение 138 пациентов показаны в Таблице 4.По состоянию на 3 февраля 2020 г. в стационаре остаются 85 пациентов (61,6%). Всего выписано 47 пациентов (34,1%), умерло 6 пациентов (4,3%). Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты, 6 умерли. Из 11 пациентов, оставшихся в ОРИТ, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​на неинвазивную вентиляцию легких). Общие осложнения среди 138 пациентов включали шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмия (23 [16,7%]) и острое повреждение сердца (10 [7,2%]). Пациенты, получавшие помощь в ОИТ, чаще имели одно из этих осложнений, чем пациенты, не получавшие ОИТ.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород и 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная искусственная вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых в качестве экстренной терапии получили экстракорпоральную мембранную оксигенацию. Вазопрессоры получали 13 пациентов, заместительную почечную терапию получали 2 пациента.

Динамический профиль лабораторных показателей у пациентов с NCIP

Для определения основных клинических особенностей, возникающих при прогрессировании НКИП, отслеживали динамическую динамику 6 клинико-лабораторных показателей, включая гематологические и биохимические показатели, с 1-го по 19-й день от начала заболевания с интервалом в 2 дня.На конец 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов отмечалась выраженная лимфопения, а у невыживших со временем развилась более тяжелая лимфопения. Количество лейкоцитов и количество нейтрофилов было выше у невыживших, чем у выживших. Уровень D-димера был выше у невыживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического состояния уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая внутрибольничная передача и инфекция

Из 138 пациентов 57 (41,3%) предположительно заразились в стационаре, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 из внутренних болезней и 5 из онкологического отделения.Из инфицированных медицинских работников 31 (77,5%) работали в общих палатах, 7 (17,5%) в отделении неотложной помощи и 2 (5%) в отделении интенсивной терапии. Один пациент в текущем исследовании имел абдоминальные симптомы и был госпитализирован в хирургическое отделение. Предполагалось, что более 10 медицинских работников этого отделения заразились от этого пациента. Также предполагалось, что имела место передача от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одном отделении были инфицированы, и у всех были атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем больной был изолирован. Впоследствии у других 3 пациентов в том же отделении была лихорадка, абдоминальные симптомы, и у них была диагностирована инфекция nCoV.

Quiz Ref IDЭтот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализации пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% выписаны, 6 умерли (4,3%), 61,6% остаются в больнице. Для тех, кто был выписан (n = 47), пребывание в стационаре составило 10 дней (IQR, 7,0-14,0). Время от начала до одышки составило 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Общими симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально были атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачности матового стекла было типичным признаком КТ для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась оксигенотерапия, и меньшинство пациентов нуждалось в инвазивной вентиляции или даже в экстракорпоральной мембранной оксигенации.

Quiz Ref IDДанные этого исследования позволяют предположить, что могла иметь место быстрая передача 2019-nCoV от человека к человеку. Основная причина вытекает из оценки основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется на новых людей, она воспроизводит себя; R 0 указывает среднее число дополнительных лиц, которых один заболевший заражает в течение болезни, и конкретно относится к популяции людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что означает, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с атипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что nCoV был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако сложно дифференцировать и проводить скрининг пациентов с атипичными симптомами. Тем не менее, быстрая передача инфекции от человека к человеку при тесных контактах является важной особенностью пневмонии, вызванной nCoV. 10 ,11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не находящимися в ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками мужского пола.По сравнению с симптомами у пациентов, не находившихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам выявить пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому, что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи относятся к стадия вспышки.

Наиболее распространенными лабораторными отклонениями, наблюдаемыми в этом исследовании, были снижение общего числа лимфоцитов, удлинение протромбинового времени и повышение уровня лактатдегидрогеназы. По сравнению с пациентами, не находившимися в отделении интенсивной терапии, у пациентов, получавших помощь в отделении интенсивной терапии, были многочисленные лабораторные отклонения. Эти аномалии предполагают, что инфекция 2019-nCoV может быть связана с дефицитом клеточного иммунитета, активацией коагуляции, повреждением миокарда, поражением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией MERS-CoV и SARS-CoV.

Динамический профиль лабораторных данных прослежен у 33 пациентов с NCIP (5 невыживших и 28 выживших). У невыживших продолжали увеличиваться количество нейтрофилов, D-димера, мочевины и креатинина в крови, а количество лимфоцитов продолжало снижаться до тех пор, пока не наступала смерть. Нейтрофилия может быть связана с цитокиновым штормом, вызванным инвазией вируса, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref IДо сих пор не было рекомендовано никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этому заболеванию заключается в контроле источника инфекции; использование средств индивидуальной защиты для снижения риска передачи инфекции; и ранняя диагностика, изоляция и поддерживающее лечение пострадавших пациентов. Антибактериальные средства малоэффективны.Кроме того, не было обнаружено никаких противовирусных средств, полезных для лечения SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировала в зависимости от тяжести заболевания. Однако эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы из дыхательных путей использовались для диагностики NCIP с помощью RT-PCR.Сыворотки больных для оценки виремии не получали. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, внутрибольничная передача/инфекция не могла быть окончательно доказана, но подозревалась и предполагалась на основании времени и моделей контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, среди 138 случаев большинство пациентов все еще находятся в больнице на момент подачи рукописи.Поэтому трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением заболевания.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая внутрибольничная передача 2019-nCoV была заподозрена у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, переписывающиеся: Чжиюн Пэн, доктор медицинских наук, отделение интенсивной терапии ([email protected]) и Xinghuan Wang, MD, Отделение урологии (wa[email protected]), Больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. правильные данные для пациентов женского пола в таблице 1.

Вклад авторов: Drs D.Ван и Пэн имели полный доступ ко всем данным исследования и брали на себя ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и разделили первое авторство. В подготовке этой статьи в равной степени участвовали доктора Пэн и X. Ван.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: D. Wang, C. Hu, Zhu, Liu, Zhang, B. Wang, Xiang, Cheng, Xiong, Peng.

Составление рукописи: D. Wang, C. Hu, Xiang, Xiong, Li, Peng.

Критическая проверка рукописи на наличие важного интеллектуального содержания: D. Wang, B. Hu, Zhu, Liu, Zhang, B. Wang, Cheng, Xiong, Zhao, X. Wang, Peng.

Статистический анализ: К. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Надзор: Б. Ху, Сюн, Чжао, С. Ван, Пэн.

Конфликт интересов Раскрытие информации: Не сообщалось.

Финансирование/поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 д-ру Д. Вану; гранты 81772046 и 81971816 д-ру Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарств в крупных национальных Научно-технические проекты Китая (2020ZX09201007, доктору Пэну).

Роль спонсора/спонсора: Спонсоры не участвовали в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Лу Х, Стрэттон CW, Танг Ю.В. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi:10.1002/jmv.25678PubMedGoogle Scholar2.Hui ДС, я Ажар Э, Мадани ТА, и другие. Продолжающаяся эпидемическая угроза новых коронавирусов 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.].  Int J Infect Dis . 2020;91:264-266. doi:10.1016/j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван Вт, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . doi:10.1056/NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.].  Ланцет . doi:10.1016/S0140-6736(20)30211-7PubMedGoogle Scholar10.Chan JF-W, Юань С, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 г., указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 г.].  Ланцет . 2020;S0140-6736(20)30154-9. doi:10.1016/S0140-6736(20)30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг КК, и другие. Импорт и передача нового коронавируса от человека человеку во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . дои: 10.1056/NEJMc2001272PubMedGoogle Scholar13.Ranieri ВМ, Рубенфельд ГД, Томпсон БТ, и другие; Целевая группа по определению ARDS. Острый респираторный дистресс-синдром: берлинское определение.  ДЖАМА . 2012;307(23):2526-2533. doi:10.1001/jama.2012.5669PubMedGoogle Scholar14.Заболевания почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Клиническое практическое руководство KDIGO при остром повреждении почек. Приложение для почек . 2012; 2:1. Google ScholarCrossref 15.Ли Кью, Гуань Х, Ву П, и другие. динамика ранней передачи в Ухане, Китай, пневмонии, инфицированной новым коронавирусом. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi:10.1056/NEJMoa2001316PubMedGoogle Scholar16.Zhang Х, Кан ZJ, Гонг ХИ, и другие. Пищеварительная система является потенциальным путем заражения 2019 nCoV: биоинформатический анализ, основанный на транскриптомах отдельных клеток. Препринт. Размещено в сети 31 января 2020 г.bioRxiv 927806. doi: 10.1101/2020.01.30.927806

Пневмония неизвестной этиологии – Китай

31 декабря 2019 г. страновое бюро ВОЗ в Китае было проинформировано о случаях пневмонии неизвестной этиологии (неизвестная причина), выявленных в городе Ухань, провинция Хубэй, Китай. По состоянию на 3 января 2020 г. национальные органы Китая сообщили ВОЗ в общей сложности о 44 пациентах с пневмонией неизвестной этиологии. Из 44 зарегистрированных случаев 11 находятся в тяжелом состоянии, а остальные 33 пациента находятся в стабильном состоянии.По сообщениям СМИ, соответствующий рынок в Ухане был закрыт 1 января 2020 года для санитарной обработки и дезинфекции окружающей среды.

Возбудитель еще не идентифицирован и не подтвержден. 1 января 2020 г. ВОЗ запросила у национальных органов дополнительную информацию для оценки риска.

Национальные власти сообщают, что все заболевшие изолированы и проходят лечение в медицинских учреждениях Уханя. Клиническими признаками и симптомами в основном являются лихорадка, у некоторых пациентов возникают трудности с дыханием, а рентгенограммы грудной клетки показывают инвазивные поражения обоих легких.

По данным властей, некоторые пациенты работали дилерами или продавцами на рынке морепродуктов Хуанань. Основываясь на предварительной информации китайской следственной группы, не было зарегистрировано никаких свидетельств значительной передачи вируса от человека к человеку и случаев заражения медицинских работников.

 

Меры общественного здравоохранения

Национальные органы сообщили о следующих мерах реагирования:

  • Выявлен 121 человек с тесным контактом, которые находятся под медицинским наблюдением;
  • Продолжается отслеживание близких контактов;
  • Ведется идентификация возбудителя и установление причины;
  • Муниципальная комиссия здравоохранения Ухани провела активное выявление случаев заболевания, и ретроспективные расследования были завершены;
  • Ведутся санитарные и санитарно-гигиенические исследования.

ВОЗ внимательно следит за ситуацией и находится в тесном контакте с национальными властями Китая.

 

Оценка рисков ВОЗ

Имеется ограниченная информация для определения общего риска этого зарегистрированного кластера пневмоний неизвестной этиологии. Сообщаемая ссылка на оптовый рынок рыбы и живых животных может указывать на связь с животными. Симптомы, зарегистрированные среди пациентов, являются общими для нескольких респираторных заболеваний, а пневмония часто встречается в зимний период; тем не менее, к возникновению 44 случаев пневмонии, требующих госпитализации, сгруппированных в пространстве и времени, следует подходить осмотрительно.

Город Ухань с населением 19 миллионов человек является столицей провинции Хубэй с населением 58 миллионов человек. ВОЗ запросила дополнительную информацию о проведенных лабораторных исследованиях и рассмотренных дифференциальных диагнозах.

 

Рекомендации ВОЗ

Согласно информации, предоставленной национальными органами, рекомендации ВОЗ по мерам общественного здравоохранения и эпиднадзору за гриппом и тяжелыми острыми респираторными инфекциями по-прежнему применяются.

ВОЗ не рекомендует никаких специальных мер для путешественников.В случае появления симптомов, указывающих на респираторное заболевание, во время или после путешествия путешественникам рекомендуется обратиться за медицинской помощью и поделиться историей поездок со своим лечащим врачом.

ВОЗ не рекомендует применять какие-либо ограничения на поездки или торговлю в Китае на основании имеющейся текущей информации об этом событии.

 

Дополнительная информация

Произошла ошибка при настройке пользовательского файла cookie

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

Настройка браузера на прием файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.

Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

Facebook снимает запрет на комментарии пользователей о том, что COVID-19 создан руками человека предполагая, что коронавирус был создан человеком.

Этот шаг был сделан после того, как главный эпидемиолог президента Байдена и царь COVID доктор Энтони Фаучи на этой неделе рассказал о том, откуда мог возникнуть вирус, сказав: «Вы никогда не знаете» — после того, как Байден приказал своим спецслужбам начать расследование. под руководством лаборатории Ухани.

В прошлом году Фаучи настаивал на том, что не было «никаких доказательств», указывающих на то, что коронавирус был изготовлен, когда Трамп упомянул об этом как о возможности.

В сообщении блога в среду, в котором было объявлено об отмене запрета, Facebook заявил: «В свете продолжающихся расследований происхождения COVID-19 и консультаций с экспертами в области общественного здравоохранения мы больше не будем удалять утверждение о том, что COVID-19 создано руками человека или изготовлено из наших приложений.

«Мы продолжаем работать с экспертами в области здравоохранения, чтобы идти в ногу с развивающимся характером пандемии и регулярно обновлять нашу политику по мере появления новых фактов и тенденций.

В апреле прошлого года Facebook объявил, что вводит ограничения на «вредную дезинформацию о COVID-19».

В феврале этого года компания объявила о том, что она расширяет свои репрессивные меры, включая заявления о том, что вирус был создан человеком. В своем блоге Facebook заявил, что не допустит теории заговора о вакцинах против COVID-19.

Социальная сеть изменилась в тот же день, когда президент Джо Байден попросил свои спецслужбы «удвоить свои усилия», чтобы точно определить происхождение коронавируса.

В прошлом году заявления администрации Трампа о том, что коронавирус мог возникнуть в лаборатории в Ухане, были встречены со скептицизмом со стороны основных СМИ, которые, по-видимому, придерживались мнения о том, что возбудитель передается от летучих мышей людям.

Facebook снял запрет на комментарии пользователей о том, что COVID-19 создан руками человека, после того как Байден (слева) приказал разведывательным агентствам расследовать, произошла ли утечка коронавируса из лаборатории в Ухане. Прав генеральный директор Facebook Марк Цукерберг

В апреле прошлого года Facebook объявил, что вводит ограничения на «вредную дезинформацию о COVID-19».

Демократы и антитрамповские комментаторы в прессе обвинили тогдашнего президента и его администрацию в продвижении теории о том, что Китай намеренно создает коронавирус, чтобы отвлечь внимание от его усилий по смягчению распространения болезни в США. .

Но недавние сообщения, появившиеся в СМИ о явном сокрытии происхождения вируса, побудили пересмотреть этот вопрос.

The Wall Street Journal сообщила в воскресенье, что работники китайского Уханьского института вирусологии были госпитализированы с болезнью, напоминающей COVID-19, — за несколько недель до того, как коронавирус начал опустошать Китай и мир.

Этот отчет, хотя и носил косвенный характер и не содержал подробностей о том, что стало с учеными, и подробной информации об их болезни, зажег новый фокус для потенциала теории.

DailyMail.com запросил комментарий в Facebook.

Утверждения о том, что вакцины неэффективны для предотвращения болезней и что безопаснее заразиться, чем получить вакцину, также были запрещены на платформе.

Сообщения с такими утверждениями будут удалены с веб-сайта, а также с принадлежащего Facebook Instagram, говорится в сообщении компании, в котором содержится список «дезинформации», которую она запрещает использовать на своих платформах.

Ранее на этой неделе Project Veritas заявила, что получила просочившиеся документы от разоблачителей внутри компании, которые доказывают, что социальная сеть тестирует алгоритм, который оценивает комментарии пользователей в соответствии с «оценкой недоверия к вакцине». согласно документам, полученным Project Veritas, другие от принятия вакцины будут понижены в должности.

The Wall Street Journal сообщила в воскресенье, что работники китайского Уханьского института вирусологии были госпитализированы с болезнью, напоминающей COVID-19, — за несколько недель до того, как коронавирус начал опустошать Китай и мир.Исследователи в лаборатории видны на этой фотографии из файла в феврале 2017 года

Как Facebook изменил свое отношение к теории лаборатории в Ухане, которая сейчас расследуется шпионской сетью Джо Байдена

Февраль 2021

чрезвычайная ситуация в области общественного здравоохранения, мы также удаляем дополнительную дезинформацию о COVID-19, которая, по мнению органов общественного здравоохранения, может привести к негативным последствиям. Утверждения, к которым мы применили это, включают, что COVID-19 создан человеком, в том числе:

  • Утверждения о том, что он был произведен или создан с помощью биоинженерии
  • Утверждения о том, что это биологическое оружие
  • Утверждения о том, что он был создан человеком , правительство или страна
  • За исключением заявлений о том, что он был изучен, получен из лаборатории или просочился из лаборатории, без специального указания на то, что он создан человеком
  • E.грамм. «Коронавирус на самом деле является биологическим оружием!»

26 мая 2021 года, когда Джо Байден запускает свой уханьский зонд

«В свете продолжающихся расследований происхождения COVID-19 и в консультации с экспертами в области общественного здравоохранения мы больше не будем удалять утверждение о том, что COVID-19 — это человек. -сделано или изготовлено из наших приложений», 

«Мы продолжаем работать с экспертами в области здравоохранения, чтобы идти в ногу с меняющимся характером пандемии и регулярно обновлять нашу политику по мере появления новых фактов и тенденций.’ 

После нескольких месяцев минимизации этой возможности в качестве маргинальной теории администрация Байдена присоединяется к международному давлению на Китай, чтобы он был более открытым в отношении вспышки, стремясь предотвратить жалобы Республиканской партии на то, что президент не был достаточно жестким, а также использовать возможность надавить на Китай в связи с предполагаемым препятствием.

Байден попросил спецслужбы США отчитаться в течение 90 дней.

Он поручил национальным лабораториям США помочь в расследовании, а разведывательному сообществу подготовить список конкретных запросов для китайского правительства.

Он призвал Китай сотрудничать с международными расследованиями причин пандемии.

Республиканцы, в том числе бывший президент Трамп, продвигают теорию о том, что вирус возник в результате лабораторной аварии, а не естественным путем в результате контакта человека с зараженным животным в Ухане, Китай.

В заявлении Байдена говорится, что большая часть разведывательного сообщества «объединилась» вокруг этих двух сценариев, но «не верит, что имеется достаточно информации, чтобы оценить, что один из них более вероятен, чем другой».

Он показал, что два агентства склоняются к связи с животными, а «одно больше склоняется» к лабораторной теории, «каждое с низкой или умеренной степенью уверенности».

«Соединенные Штаты также будут продолжать работать с партнерами-единомышленниками по всему миру, чтобы убедить Китай принять участие в полном, прозрачном, основанном на доказательствах международном расследовании и предоставить доступ ко всем соответствующим данным и доказательствам», — сказал Байден.

Его заявление прозвучало после того, как администрация несколько недель пыталась избежать публичного обсуждения теории об утечке из лаборатории и в частном порядке предположила, что она надуманная.

Другим признаком изменения отношения является то, что Сенат без возражений одобрил две поправки, касающиеся лаборатории в Ухане, прикрепив их к в значительной степени не имеющему отношения к делу законопроекту об увеличении инвестиций США в инновации.

На снимке: Лаборатория в Ухане, откуда, по некоторым утверждениям, возник Covid-19, что было оспорено исследователями ВОЗ 9 февраля

На снимке: Рынок морепродуктов Хуанань, 9 февраля 2021 г. сайт, с которого началась пандемия

Какие еще заявления о Covid-19, которые были открытыми для обсуждения среди ученых, были запрещены Facebook?

«Ношение лицевой маски не помогает предотвратить распространение Covid-19»

Все согласны с тем, что маски лучше, чем ничего, потому что они обеспечивают некоторую, но не полную защиту от людей, вдыхающих вирус, и, вероятно, останавливают многие вирус, если носитель является инфицированным человеком.

Исследования, проведенные в 2020 и 2021 годах, выявили противоречия: некоторые отмечают, что они эффективно останавливают выдыхание тысяч потенциально заразных капель и что надлежащие медицинские маски могут предотвратить 99% передачи инфекции.

Другой в Дании обнаружил, что носители масок с такой же вероятностью могут заразиться вирусом, как и люди без масок, а Университет штата Нью-Мексико обнаружил, что капли все еще могут проникать через ткань.

«Социальное дистанцирование не помогает предотвратить распространение Covid-19»

Фундаментальный принцип социального дистанцирования — держаться подальше от других людей — безусловно, является хорошим способом остановить распространение вируса.Но ученые и власти разошлись во мнениях относительно подходящих расстояний.

В Великобритании правило составляет 2 метра (6 футов 6 футов) или «один метр плюс», если кто-то носит маску или находится на улице или за экраном. Эксперты заявили, что почти никакие вирусные частицы не могут пройти через 2 метра движущегося воздуха, чтобы заразить кого-либо.

Но Всемирная организация здравоохранения менее строга, и ее официальное руководство по социальному дистанцированию гласит, что люди должны находиться на расстоянии 1 м (3 фута 3 фута). Некоторые страны последовали этому примеру, в то время как другие были более осторожны, например, Великобритания.

Исследование, проведенное Массачусетским технологическим институтом в Бостоне, показало, что социальное дистанцирование в помещении может дать людям ложное чувство безопасности и что этого недостаточно, чтобы остановить распространение Covid, который передается по воздуху.

«Вакцины против Covid-19 убивают или серьезно вредят людям»

Никто не умер или не заболел серьезно из-за вакцины в клинических испытаниях основных прививок, используемых в Европе, США и Австралии, которые доказали ученым, что они достаточно безопасен для использования среди населения в целом.

Но с тех пор, как они были предоставлены сотням миллионов людей во всем мире, у крошечной части людей, получающих вакцины на основе вирусов, такие как вакцины AstraZeneca или Johnson & Johnson, образовались тромбы. Еще меньшее число этих людей умерло — предположительно, в результате образования тромбов.

Риск этого для большинства взрослых — и всех взрослых в странах с крупными вспышками — значительно меньше, чем риск смерти от Covid.

Безопасность вакцин постоянно контролируется и подробно сообщается учеными и медицинскими регулирующими органами по всему миру.

Но свертывание крови настолько обеспокоило некоторые правительства, что они запретили некоторым возрастным группам использовать вакцину AZ или решили не использовать ее вообще.

Одна из поправок, внесенная сенатором Рэндом Полом, республиканцем из Кентукки, заблокирует финансирование США китайских исследований «усиления функции» по повышению серьезности или трансмиссивности вируса.

Пол критиковал доктора Энтони Фаучи, главного правительственного эксперта по инфекционным заболеваниям, и агрессивно допрашивал его на недавних слушаниях в Сенате по поводу работы в Китае.

Другая поправка была внесена сенатором Республиканской партии Джони Эрнстом из Айовы, и она предотвратит любое финансирование Уханьского института вирусологии.

Оба были одобрены без поименного голосования в рамках более широкого законопроекта, который все еще обсуждается в Сенате.

Что касается происхождения пандемии, Фаучи, советник Белого дома по коронавирусу, заявил в среду, что он и большинство других представителей научного сообщества «считают, что наиболее вероятным сценарием является то, что это было естественным явлением, но никто не знает, что на 100 процентов для уверенности.’

‘И так как есть много беспокойства, много спекуляций и так как никто не знает этого, я считаю, что нам действительно нужно такое расследование, при котором есть открытая прозрачность и вся доступная информация, которая должна быть доступна, чтобы тщательно изучить», — сказал Фаучи на слушаниях в Сенате.

Пресс-секретарь Белого дома Джен Псаки заявила во вторник, что Белый дом поддерживает новое расследование Всемирной организации здравоохранения в Китае, но добавила, что эффективное расследование «потребует, чтобы Китай наконец активизировался и предоставил доступ, необходимый для определения происхождения».

Байден по-прежнему допускал возможность того, что твердого вывода никогда не будет сделано, учитывая отказ китайского правительства в полной мере сотрудничать с международными расследованиями.

«Неспособность доставить наших инспекторов на место в первые месяцы всегда будет препятствовать любому расследованию происхождения COVID-19», — сказал он.

 

Чиновники администрации продолжают питать большие сомнения по поводу теории об утечке из лаборатории.

Скорее, они рассматривают отказ Китая сотрудничать в расследовании — особенно в деле такого масштаба — как символ других безответственных действий на мировой арене.

В частном порядке чиновники администрации говорят, что конечный результат, если он когда-либо станет известен, ничего не изменит, но обратите внимание, что китайская каменная стена теперь выставлена ​​на всеобщее обозрение.

Государственный департамент, завершивший весной этого года одно расследование эпохи Трампа в отношении теории китайской лаборатории, заявил, что продолжает сотрудничать с другими государственными учреждениями, и потребовал от Китая сотрудничества со всем миром.

«Позиция Китая о том, что его участие в этом расследовании завершено, разочаровывает и расходится с остальным международным сообществом, которое совместно работает над тем, чтобы положить конец этой пандемии и улучшить глобальную безопасность в области здравоохранения», — сказал представитель Нед Прайс. .

Исследование происхождения вируса крайне важно, сказал Аринджай Банерджи, вирусолог из Организации по вакцинам и инфекционным заболеваниям в Саскачеване, Канада, потому что: «Если вы не знаете, откуда он взялся, как вы собираетесь остановить его от повторного распространения?»

«По-прежнему велика вероятность того, что этот вирус пришел из резервуара дикой природы», — сказал он, указывая на тот факт, что случаи распространения — когда вирусы переходят от животных к людям — обычны в природе, и что ученые уже знают о двух похожих бета-коронавирусах, которые развились у летучих мышей и вызвали эпидемии при заражении людей, — SARS1 и MERS.

«Имеющиеся у нас данные свидетельствуют о том, что этот вирус пришел из дикой природы», — сказал он.

Однако дело не закрыто полностью.

— Есть вероятности, а есть возможности, — сказал Банерджи.

«Поскольку никто не идентифицировал вирус, который на 100% идентичен SARS-CoV-2 у любого животного, у исследователей все еще есть возможность узнать о других возможностях»,

Энди Славитт, старший советник Байдена по коронавирусу, сказал Во вторник, что миру нужно «докопаться до сути»… каким бы ни был ответ».

«Нам нужен полностью прозрачный процесс из Китая; нам нужна помощь ВОЗ в этом вопросе», — сказал Славитт.

«Мы не чувствуем, что у нас это есть сейчас».

Разворот либеральных СМИ США в отношении Covid: через год после того, как теория о том, что COVID возникла в лаборатории в Ухане, потому что Трамп поддержал это предложение, внезапно вспыхнула. спрашиваю правда ли это!

Либеральные СМИ наконец-то признали, что COVID-19 мог возникнуть в лаборатории Уханя — после года высмеивания этого предположения.

О первом летальном исходе от COVID-19 китайские государственные СМИ сообщили 11 января 2020 года, когда скончался 61-летний мужчина, который был постоянным покупателем на рынке в Ухане. Первый подтвержденный случай в США был 10 дней спустя, когда мужчина вернулся в штат Вашингтон из Ухани.

В течение недели, 26 января 2020 года, в The Washington Times была опубликована первая статья, обвиняющая Уханьский институт вирусологии во вспышке. Тем не менее, большинство основных СМИ оспаривали утверждения, полностью отвергая их или даже осуждая как расистские.

Когда 1 мая 2020 года Дональд Трамп заявил, что у него «высокая степень уверенности» в том, что вирус вышел из лаборатории, New York Times, CNN и NPR поспешили высмеять его комментарии.

CNN, которая к концу правления Трампа демонстрировала наглую враждебность к президенту и его советникам, почти ликовала, высмеивая идею о том, что вирус мог появиться в лаборатории.

The Washington Post, New York Times и NPR в равной степени отвергли предположения о том, что вирус мог появиться в лаборатории.

Некоторые издания, такие как Huffington Post, даже заклеймили любое предположение, что вирус мог появиться в лаборатории, как «ядовитую теорию заговора».

The Washington Post 25 мая опубликовала статью для проверки фактов, в которой говорится, что теория «внезапно» стала заслуживающей доверия после того, как она неоднократно поднималась. Это появилось после года отрицания со стороны либеральных СМИ, которые так и не признали, что это может быть правдой

Существует возмущение по поводу того факта, что за последний год эта теория была широко дискредитирована американскими СМИ, хотя она может объяснить весь пандемия 

Мало кто мог предположить, что COVID-19 мог возникнуть в исследовательском центре, не получив негативной реакции, но это не помешало некоторым СМИ, в том числе Daily Mail, подвергнуть сомнению повествование.

Такер Карлсон из Fox News также четко потребовал расследования того, мог ли он сбежать из лаборатории.

Наконец, за последние несколько месяцев появились первые признаки того, что мнение начало меняться.

В январе отчет Всемирной организации здравоохранения (ВОЗ) вызвал дополнительные вопросы только после того, как Пекин строго контролировал визит на место и то, с кем беседовали исследователи, составлявшие отчет. Команде ВОЗ было разрешено находиться в лаборатории Уханя только три часа, и она не смогла изучить какие-либо журналы безопасности Уханьского института или записи о тестировании его персонала.

Действия Китая привели к тому, что Белый дом Байдена призвал к большей прозрачности.

Даже д-р Тедрос Адханом Гебрейесус, генеральный директор ВОЗ, сказал, что визит был безрезультатным, добавив, что «все гипотезы открыты» и требуют дальнейшего изучения.

К 11 мая Фаучи признал, что идея побега вируса из лаборатории была отвергнута слишком быстро.

На вопрос, возник ли вирус естественным путем, Фаучи ответил, что хочет более подробно изучить этот вопрос.

— Я в этом не уверен, — сказал он. «Я думаю, что мы должны продолжать расследование того, что произошло в Китае, пока мы не продолжим выяснять, насколько это возможно, что произошло.

‘Конечно, люди, проводившие расследование, говорят, что это, вероятно, было выходом из животного резервуара, который затем заразил людей, но это могло быть и что-то другое, и нам нужно это выяснить. Итак, вы знаете, именно поэтому я сказал, что полностью поддерживаю любое расследование, которое изучает происхождение вируса.’

Откровение Фаучи стало шоком для многих левых, которые приняли версию Китая о том, что коронавирус распространился с влажного рынка с момента его первого появления.

Конечно, Китай продолжает настаивать на том, что COVID-19 не возник в лаборатории Ухани.

«США продолжают придумывать противоречивые утверждения и требовать расследования лабораторий в Ухане», — говорится в письменном заявлении министерства иностранных дел Китая от 24 мая. Это полностью показывает, что некоторым людям в США нет дела до фактов и правды.’ 

Daily Mail с апреля 2020 года спрашивает, произошел ли вирус из лаборатории в Ухане

The Daily Mail постоянно подвергает сомнению мнение о том, что COVID-19 передается от людей к животным.

Наши корреспонденты вникли в детали и поставили под сомнение предположения о происхождении пандемии.

4 АПРЕЛЯ 2020 ГОДА: 

Произошла ли утечка коронавируса из исследовательской лаборатории в Ухане? Поразительная новая теория «больше не сбрасывается со счетов» на фоне заявлений о том, что сотрудники «заразились после того, как их опрыскали кровью»

Министры опасаются, что пандемия коронавируса могла быть вызвана утечкой из китайской лаборатории, сообщает The Mail on Sunday.

Высокопоставленные правительственные источники говорят, что, хотя «баланс научных рекомендаций» по-прежнему заключается в том, что смертельный вирус был впервые передан людям с рынка живых животных в Ухане, утечка из лаборатории в китайском городе «больше не сбрасывается со счетов» .

Один из членов комитета по чрезвычайным ситуациям Кобры во главе с Борисом Джонсоном заявил вчера вечером, что, хотя последние разведданные не оспаривают, что вирус был «зоонозным» — происходящим от животных, — он не исключает, что вирус впервые распространился на людей после утечки из уханьской лаборатории.

15 АПРЕЛЯ 2020 г.:

Майк Помпео требует от Пекина правды, поскольку США расследуют, сбежал ли COVID-19 из лаборатории Ухани во время экспериментов, и Китай скрыл это, обвиняя «мокрые» продовольственные рынки

Госсекретарь Майк Помпео потребовал, чтобы Китай «признался» после сообщений о том, что коронавирус возник в китайской лаборатории не как биологическое оружие, а как часть неуклюжих экспериментов, доказывающих, что китайские ученые превосходят американцев в выявлении новых вирусных угроз.

Это произошло после того, как президент Дональд Трамп заявил в среду, что США пытаются определить, случайно ли коронавирус впервые попал к людям во время экспериментов с летучими мышами в лаборатории Уханьского института вирусологии.

После того, как известие о вспышке наконец стало достоянием общественности, китайские лидеры поспешили обвинить «мокрый рынок» Уханя, где дикие животные, но не летучие мыши, продаются для потребления, что привело к тому, что один источник сообщил Fox News, что фиаско является «самым дорогостоящим». правительственное сокрытие всех времен.

2 мая 2020 г .:

Уханьская вирусная лаборатория «сокрытие»: с веб-сайта китайского института в центре глобального подозрения в отношении пандемии исчезают поразительные фотографии ученых, почти не защищенных при работе с образцами смертоносных летучих мышей

которые, по-видимому, демонстрируют слабые стандарты безопасности в китайской лаборатории, находящейся в центре международного подозрения в отношении Covid-19, систематически удаляются с ее веб-сайта, поскольку Дональд Трамп продолжает усиливать давление на Пекин в связи с его потенциальной ролью во вспышке.

За последний месяц Уханьский институт вирусологии удалил фотографии ученых, работающих в своих лабораториях, и вырезал ссылки на визиты американских дипломатов, которые впоследствии подняли тревогу по поводу работы лаборатории над летучими мышами.

Президент США Дональд Трамп объявил в четверг, что он видел разведданные, которые вселили в него «высокую степень уверенности» в том, что глобальный кризис возник в институте — через месяц после того, как The Mail on Sunday впервые сообщила, что британские министры кабинета получили секретные брифинги, поднимающие вероятность утечки из института.

Даунинг-стрит не восприняла замечания президента Трампа. «Очевидно, что необходимо ответить на вопросы о происхождении и распространении вируса», — сказал представитель Бориса Джонсона.

30 мая 2020 г.:

Теперь Пекин признает, что коронавирус НЕ появился на рынке Ухани… так откуда он взялся

Китай привык к публичным признаниям по телевидению. Но на этот раз слова исходили от одного из высших должностных лиц страны и имели глобальные последствия.

«Сначала мы предполагали, что на рынке морепродуктов может быть вирус, но теперь рынок больше похож на жертву», — сказал Гао Фу, директор Центра по контролю и профилактике заболеваний.

Первоначальный анализ Гао имел смысл после предыдущих вспышек зоонозных вирусов (заболеваний, передающихся от животных человеку). Тем не менее, подозрения росли в связи с тем, что китайское правительство не предоставило данные о животных, отобранных на рынке после его раннего сокрытия.

2 ЯНВАРЯ 2021 г.: 

Утечка из китайской лаборатории является «наиболее достоверным» источником вспышки коронавируса, заявил высокопоставленный правительственный чиновник США на фоне сенсационных заявлений уханьского ученого, который стал информатором 

Один из самых высокопоставленных правительственных чиновников Америки говорит, что наиболее «Надежная» теория о происхождении коронавируса заключается в том, что он сбежал из лаборатории в Китае.

Мэтью Поттинджер, уважаемый заместитель советника президента Дональда Трампа по национальной безопасности, заявил политикам со всего мира, что даже лидеры Китая теперь открыто признают, что их предыдущие утверждения о том, что вирус возник на рынке в Ухане, являются ложными.

Г-н Поттингер сказал, что последние разведданные указывают на утечку вируса из сверхсекретного Уханьского института вирусологии, расположенного в 11 милях от рынка: «Появляется все больше доказательств того, что лаборатория, вероятно, является наиболее надежным источником вирус.’

9 ЯНВАРЯ 2021:

Новые опасения сокрытия, поскольку китайские официальные лица удаляют важные данные о лаборатории в Ухане с исчезновением деталей 300 исследований, включая все исследования, проведенные вирусологом по прозвищу Бэтвумен

Китайское правительство сталкивается с новыми обвинениями сокрытия после того, как официальные лица удалили важные онлайн-данные о лаборатории, подозреваемой в том, что она является источником Covid-19.

The Mail on Sunday может сообщить, что сотни страниц информации, касающейся исследований, проведенных сверхсекретным Уханьским институтом вирусологии, были стерты.

Подробная информация о более чем 300 исследованиях, в том числе о многих исследованиях болезней, передающихся от животных к человеку, опубликованных в Интернете государственным Национальным фондом естественных наук Китая (NSFC), больше недоступна.

24 апреля 2021 г.:

Тревожные новые подсказки о происхождении Covid: как ученые из лаборатории Ухани помогли китайской армии в секретном проекте по поиску вирусов животных

Ученые, изучающие болезни летучих мышей в китайской лаборатории строгого режима в Ухане масштабный проект по исследованию вирусов животных вместе с ведущими военными, несмотря на их отрицание любых подобных связей.

Документы, полученные газетой The Mail on Sunday, показывают, что девять лет назад была запущена общенациональная схема, управляемая ведущим государственным органом, для обнаружения новых вирусов и обнаружения «темной материи» биологии, участвующей в распространении болезней.

CNN

1 мая 2020 года CNN сообщило, что Трамп «противоречил» разведывательному сообществу, заявив, что видел доказательства того, что вирус пришел из лаборатории.

«Президент Дональд Трамп опроверг редкое официальное заявление своего разведывательного сообщества, заявив в четверг, что он видел доказательства, дающие ему «высокую степень уверенности» в том, что новый коронавирус возник в лаборатории в Ухане, Китай. но отказался предоставить детали, подтверждающие его утверждение.

«Комментарии подрывают публичное заявление Управления директора национальной разведки, опубликованное всего несколько часов назад, в котором говорится, что такая оценка не проводилась, и что продолжается «тщательное изучение», началась ли вспышка в результате контакта с инфицированными животными или был результатом несчастного случая в лаборатории в Ухане».

«Да, видел», — сказал Трамп, когда его спросили, видел ли он доказательства того, что вирус возник в лаборатории. Позже, когда его спросили, почему он уверен в этой оценке, Трамп возразил.

1 мая 2020 г .: 1 мая 2020 г. CNN сообщила, что Трамп «противоречил» сообществу разведки, заявив, что видел доказательства того, что вирус пришел из лаборатории. Они указали на то, как редко разведывательное сообщество делало заявления

5 МАЯ 2020 ГОДА: Крис Силлизза написал авторскую статью, в которой говорится, что Фаучи «разбил теорию Трампа» о происхождении вируса

«Я не могу вам сказать это. Мне не разрешено говорить вам об этом», — говорилось в отчете.

Затем, 5 мая 2020 года, их главный редактор Крис Силлизза написал резкую критику предложения под названием: Энтони Фаучи только что разгромил теорию Дональда Трампа о происхождении коронавируса.

‘Прежде чем мы сыграем в игру «он сказал, он сказал», запомните следующее: только один из этих двух человек является всемирно известным экспертом по инфекционным заболеваниям. И это не Дональд Трамп», — написал Силлизза.

«Короче говоря, точка зрения Фаучи на происхождение болезни имеет гораздо большее значение, чем мнение Трампа о том, откуда она взялась.

«Особенно потому, что за пределами Трампа и его ближайшего окружения большинство людей, которые могут знать, очень, очень скептически относятся к рассказу Трампа о том, что вирус вышел из лаборатории — случайно или намеренно.

Статья Силлиззы последовала за статьей, опубликованной четырьмя днями ранее, под заголовком: «Трамп противоречит разведывательному сообществу США, утверждая, что он видел доказательства того, что коронавирус возник в китайской лаборатории».

Но перенесемся почти на год вперед, и тон сильно изменился.

Доктор Санджай Гупта, главный медицинский корреспондент CNN, говорил 26 марта этого года с Робертом Редфилдом, бывшим директором Центров по контролю и защите от болезней (CDC).

Редфилд сказал, что пришел к выводу, что вирус сбежал из лаборатории.

«Я придерживаюсь точки зрения, что я все еще думаю, что наиболее вероятная этиология этого патогена в Ухане была из лаборатории, знаете ли, сбежавшей», — сказал он.

‘Теперь другие люди не верят в это, это нормально. В конце концов наука это выяснит.

ОКТЯБРЬ 2020: CNN опубликовала еще один отчет о том, как теория возникла из «дрянной» статьи, которую поддержал Бэннон. В нем утверждалось, что за этой теорией нет никаких доказательств.

МАРТ 2021: Бывший глава CDC доктор Роберт Редфилд в эфире CNN в марте 2021 года заявил, что, по его мнению, вирус пришел из лаборатории.Он сказал репортеру: «Я придерживаюсь точки зрения, я все еще думаю, что наиболее вероятная этиология этого патогена в Ухане была из лаборатории, сбежала. Другие люди в это не верят. Это нормально, наука в конце концов это выяснит. Нет ничего необычного в том, что респираторные патогены, над которыми работают в лаборатории, заражают лаборанта». CNN назвал это «спорным»

МАЙ 2021: 24 мая был опубликован новый отчет, в котором говорилось, что разведка США обнаружила некоторые доказательства того, что вирус пришел из лаборатории в Ухане

«Это не редкость для респираторных патогенов, над которыми работают. в лаборатории, чтобы заразить работника лаборатории.

23 мая The Wall Street Journal сообщил, что трое исследователей из Уханьского института вирусологии заболели в ноябре 2019 года настолько, что обратились за медицинской помощью, согласно ранее нераскрытому отчету разведки США

На следующий день газета сообщила о таинственная шахта примерно в 80 милях от Уханя, где в апреле 2012 года шесть горняков заболели после того, как вошли в шахту, чтобы очистить гуано летучих мышей. Трое из них погибли.

Китайские ученые из Уханьского института вирусологии были вызваны для расследования и, взяв образцы у летучих мышей в шахте, выявили несколько новых коронавирусов.Тем не менее, они не были готовы со своей информацией.

24 мая CNN признал, что в лаборатории Уханя может быть больше, чем предполагалось изначально. Они опубликовали обновление: Новая информация о болезни ученых из Ухани способствует спорам о происхождении пандемии

Но Силица по-прежнему настаивает на своих прежних утверждениях, что это не так.

Он написал статью о том, почему д-р Фаучи «страховался» по этому вопросу, и сказал, что только потому, что Фаучи сказал, что он больше не «убежден» в происхождении, это не значит, что он думал, что это произошло из лаборатории.

New York Times

Когда кто-либо из законодателей, поддерживающих Трампа, заявил, что теория уханьской лаборатории заслуживает дальнейшего изучения, New York Times быстро отклонила их заявление.

В первый месяц пандемии они ухватились за вопросы, поднятые Томом Коттоном, сенатором-республиканцем от штата Арканзас.

— У нас нет доказательств того, что эта болезнь возникла там, — сказал Коттон.

‘Но из-за двуличия и нечестности Китая с самого начала нам нужно хотя бы задать вопрос, чтобы увидеть, что говорят доказательства, а Китай сейчас вообще не дает показаний по этому вопросу.

Его слова от 17 февраля 2020 года окажутся пророческими, но New York Times озаглавила свое сообщение: Сенатор Том Коттон повторяет крайнюю теорию происхождения коронавируса.

К 30 апреля 2020 года газета описывала попытки администрации Трампа разобраться в происхождении вируса как политическую охоту на ведьм. (справа) официальные лица подталкивали шпионов к поиску доказательств, лежащих в основе теории нынешним и бывшим американским чиновникам», — сообщает газета.

«Усилия предпринимаются по мере того, как президент Трамп усиливает публичную кампанию по обвинению Китая в пандемии».

Статья была озаглавлена: «Говорят, что официальные лица Трампа давят на шпионов, чтобы связать вирус и уханьские лаборатории» во время ссоры из-за его языка во время тура по Перу — оба сказали, что теперь они считают возможным, а может быть, даже вероятным, что вирус пришел из лаборатории.

«В начале весны 2020 года я сообщил о статье для The New York Times, к которой я добавил предварительный заголовок: «Новый коронавирус — это явно не лабораторная утечка», — написал Макнил на Medium.

‘Он никогда не запускался.’

Он сказал, что газета резко разделилась по поводу того, верить ли официальным лицам Трампа, говорящим, что это была утечка из лаборатории, или ученым, говорящим, что это не так.

‘Мы до сих пор не знаем источник этой ужасной пандемии. Возможно, мы никогда не узнаем», — написал он.

‘Но аргумент, что он мог просочиться из Уханьского института вирусологии или сестринской лаборатории в Ухане, стал значительно сильнее, чем год назад, когда крики были настолько громкими, что заглушали серьезное обсуждение.

Макнейл, покинувший The New York Times ранее в этом году, сказал, что «отсутствие откровенности» Китая «вызывает тревогу». Макнил был уволен Times после того, как выяснилось, что он использовал слово на букву N во время разговора со студентами во время поездки, организованной NYT. 17 мая он опубликовал статью на эту тему. Он сказал, что ученые «подавляюще» сказали ему, что это не из лаборатории

МАЙ 2021: Теперь Times повторяет призывы ученых к непредвзятости в отношении теории

«И отсутствие откровенности Китая вызывает беспокойство .’

Уэйд пришел к такому же выводу.

‘Пока нельзя исключать ни естественное возникновение, ни гипотезу побега из лаборатории. Прямых доказательств ни того, ни другого до сих пор нет. Так что никакого окончательного вывода сделать нельзя», — написал он.

‘Тем не менее, имеющиеся улики больше склоняются в одну сторону, чем в другую. Читатели составят собственное мнение.

‘Но мне кажется, что сторонники побега из лаборатории могут объяснить все имеющиеся факты о SARS2 значительно легче, чем сторонники естественного возникновения.

Washington Post

Репортеры для статьи, опубликованной 30 апреля 2020 года, представили детальный и глубокий анализ работы лаборатории в Ухане и подчеркнули связанные с этим риски.

Тем не менее, их заголовок гласил: Китайская лаборатория провела обширные исследования смертоносных вирусов летучих мышей, но нет никаких доказательств случайного выброса.

На следующий день пренебрежительный тон продолжился: был ли новый коронавирус случайно выпущен из лаборатории в Ухане? Это сомнительно.

В мае 2020 г. The Washington Post заявила, что «сомнительно» происхождение вируса из лаборатории в статье из раздела «Проверка фактов»

Теперь Washington Post призывает ВОЗ провести расследование случившегося, чтобы определить, не действительно пришло из лаборатории

МАЙ 2021: Журналист Аарон Блейк написал, что это «раздражает» как предмет.Он сказал: «Стало очевидным, что некоторые уголки основных средств массовой информации чрезмерно исправили, когда дело дошло до одной конкретной теории Трампа и его союзников: что коронавирус возник из лаборатории в Ухане, Китай, а не естественным путем. Верно также и то, что многие критические замечания в адрес освещения слишком натянуты, а заявления Трампа и его союзников вызвали и заслужили скептицизм».

К 24 мая этого года газета была близка к тому, чтобы признать, что они были слепы.

«Учитывая все, что мы знаем о том, как Трамп справлялся с такими вещами, следовало проявлять осторожность и скептицизм», — написал Аарон Блейк, старший политический репортер газеты.

«Эта (весьма оправданная) осторожность и скептицизм вылились в некоторое чрезмерное упрощение, особенно когда дело дошло до обобщения часто более осмотрительных отчетов».

Он признал: «Возможно, мы никогда не узнаем правду».

Huffington Post

Поскольку весной 2020 года беспокойство по поводу вируса росло, Huffington Post быстро высмеивала все вопросы о его происхождении.

«Токсичная «инфодемия»: вирусное распространение теорий заговора о COVID-19», — озаглавили они статью от 7 апреля 2020 года.

АПРЕЛЬ 2020: The Huffington Post изначально скептически (слева) отнеслась к альтернативным идеям, связанным с COVID, и назвала это «инфодемией». Чуть больше года спустя, 24 мая этого года, сайт продолжил отчет Wall Street Journal о госпитализации работников лаборатории в Ухане в 2019 году и о проблемах, которые это вызвало.

«Уханьские исследователи были госпитализированы с симптомами COVID-19 до пандемии: отчеты», — написали они.

NPR

23 апреля 2020 года NPR заявило: «Исследователи вирусов говорят, что практически нет шансов, что новый коронавирус был выпущен в результате лабораторной аварии в Китае или где-либо еще».

Сеть радионовостей была полна решимости доказать, что теория утечки из лаборатории Уханя не заслуживает доверия, и выпустила серию «объяснений», настаивающих на том, что COVID-19 передается от животных к людям.

«Откуда взялся этот коронавирус? Охотники за вирусами находят генетические подсказки у летучих мышей», — сообщили они 15 апреля 2020 года.

Тем не менее, чуть более года спустя, NPR с интересом следил за отчетом ВОЗ и его тревожными выводами.

«Теория о том, что COVID пришел из китайской лаборатории, обретает новую жизнь после доклада ВОЗ», — заключили они.

АПРЕЛЬ 2020 ГОДА: Национальное общественное радио изначально отвергало предположения о том, что вирус просочился из лаборатории (слева), но к маю 2021 года стало освещать растущие предположения 

МАРТ 2021 ГОДА: стали более открытыми 

31 марта они сообщили: призывают к открытому расследованию возможности утечки COVID-19 из лаборатории.

Среди тех, кто следил за новостями, был Майк Помпео, госсекретарь Трампа.

«Больше года назад я сказал @MarthaRaddatz, что Уханьский вирус, скорее всего, возник в результате утечки из лаборатории», — написал он в Твиттере 20 мая. КПК сказала, что я враг человечества», — сказал он, имея в виду Коммунистическую партию Китая.

‘А сейчас? Ну, а теперь левые СМИ изо всех сил стараются встать на сторону правды».

Пекинский спортивный университет — Ухань Три города оценка ≻ 26.09.2021 ≡ счет матча ≡ 777score.ru

Факты совпадения

Ухань Три Таунс имеет выигрышную серию из 5 матчей на выезде.

Beijing Sport University выигрывает первую половину матча в 22% случаев, Wuhan Three Towns выигрывает в 48%.

Победителем прошлой встречи была команда Ухань Три Таунс.

Выездная статистика Ухань Три Таунс в сезоне 8-2-1.

Когда Пекинский спортивный университет лидирует дома со счетом 1: 0, они побеждают в 71% своих матчей.

Ухань Три Таунс не проиграли ни в одном из последних 6 выездных матчей.

Когда Ухань Три Таунс проигрывает 1-0 на выезде, они побеждают в 0% своих матчей.

Beijing Sport University выигрывает первый тайм в 22% матчей, Wuhan Three Towns выигрывает в 48% матчей.

Выступление команды Wuhan Three Towns в China League 1 лучше, чем у команды Beijing Sport University.

Beijing Sport University забивает 1,19 гола, играя дома, а Wuhan Three Towns забивает 1,95 гола, играя на выезде (в среднем).

Beijing Sport University без побед в последних 4 играх.

Ухань Три Таунс не проигрывает в последних 12 играх.

Когда Пекинский спортивный университет проигрывает дома 0:1, они побеждают в 0% своих матчей.

Ухань Три Таунс имеет выигрышную серию из 8 матчей.

Результаты команды

Wuhan Three Towns в последних 5 матчах лучше, чем у команды Beijing Sport University.

В их последнюю встречу команда Ухань Три Таунс победила в 4 гол(а).

Год назад Пекинский спортивный университет был на 7 месте в таблице с 35 очками.Сейчас они на 15-м месте с 16 очками.

Когда Ухань Три Таунс лидирует 0-1 на выезде, они побеждают в 81% матчей.

Ухань Три Таунз забивали хотя бы раз в 21 матче подряд.

Wuhan Three Towns имеет выигрышную серию из 7 матчей в China League 1.

Знаете ли вы, что Пекинский спортивный университет забил 33% голов между минутами 61-75? Это самый высокий процент в лиге.

Пекинский спортивный университет не забивает в 4 из 11 домашних матчей в Китайской лиге 1 в этом сезоне.

Три города Ухань не забили в 0 из 10 выездных матчей в China League 1 в этом сезоне.

Знаете ли вы, что Ухань Три Таунс забил 24% голов между минутами 76-90?

Показать больше

Обучение английскому языку в онлайн-колледже в Ухане в условиях пандемии COVID-19: готовность студентов и преподавателей, проблемы и последствия. | PLoS One;16(10): e0258137, 2021.

РЕФЕРАТ

Онлайн-образование, в том числе обучение английскому языку в колледже, в последнее десятилетие быстро развивается в Китае.Такие аспекты, как электронная готовность, преимущества и проблемы онлайн-образования, были хорошо изучены в обычных ситуациях, но полномасштабное онлайн-обучение языку в чрезвычайных ситуациях может рассказать другую историю. Был проведен опрос 2310 студентов колледжей, не изучающих английский язык, и 149 преподавателей английского языка из трех типов двенадцати высших учебных заведений в Ухане, чтобы оценить их готовность к онлайн-обучению английскому языку во время пандемии COVID-19, чтобы выяснить проблемы, с которыми они сталкиваются, и сделать выводы для будущего обучения английскому языку в онлайн-колледже.Количественные статистические данные, собранные с использованием двух шкал готовности, адаптированных из предыдущих исследований, показали, что обе группы были немного ниже уровня готовности к неожиданному онлайн-переходу на обучение английскому языку в колледже. Общий уровень готовности студентов составил 3,68 из 5 баллов, учителей – 3,70. Индивидуальные различия были исследованы и зарегистрированы. Анализ качественных результатов обобщил шесть категорий проблем, с которыми столкнулись студенты, т. е. технические проблемы, проблемы, связанные с процессом обучения, учебной средой, самоконтролем, эффективностью и результативностью, а также заботой о здоровье.Хотя студенты сообщили о самом высоком уровне готовности к доступу к технологиям, их больше всего беспокоили технические проблемы во время онлайн-обучения. Учителей из трех типов проблем больше всего раздражали педагогические, особенно отстраненность учащихся от онлайн-класса. Опрос позволил получить представление о развитии онлайн-обучения английскому языку в колледже. Вузы должны взять на себя инициативу и продолжать способствовать развитию онлайн-обучения английскому языку в колледжах, поскольку большинство респондентов сообщили о своей готовности и намерении продолжать изучение/преподавание английского языка на онлайн-курсах или смешанных курсах в постпандемический период.Предполагается, что они устранят технические барьеры для учителей и учеников и оценят уровень готовности обеих групп перед запуском онлайн-курсов английского языка. Учреждения также должны организовать надлежащую подготовку инструкторов, особенно по педагогическим вопросам. Преподавателям иностранных языков предлагается обратить особое внимание на вовлеченность и общение студентов на онлайн-курсах.

Картографирование подтвержденных случаев Covid-19 и смертей во всем мире

Данные тестирования по состоянию на

Вступая в третий год пандемии коронавируса, более   человек были инфицированы, и вирус убил более  во всем мире.Усилия, предпринятые многими странами для искоренения болезни, похожей на пневмонию, привели к тому, что целые страны ввели карантин, повсеместные остановки международных поездок, массовые увольнения и обрушились финансовые рынки. Новые варианты вируса привели к новым волнам случаев заболевания, хотя новые лекарства и улучшенный уход могут помочь выжить большему количеству тяжелобольных людей.

Переход к более плоской кривой 👆

Первые дни с более чем 100 подтвержденными случаями

Примечание. Отчетность JHU CSSE началась 22 января 2020 г., когда в материковом Китае уже было зарегистрировано более 500 случаев.

Источник: Центр системных наук и инженерии Университета Джона Хопкинса

.

Подтвержденных случаев по всему миру

Юрисдикции с делами, подтвержденными по состоянию на

  • 1–99
  • 100–999
  • 1 000–9 999
  • 10 000–99 999
  • 100 000–999 999
  • 1 000 000–9 999 999
  • 10 миллионов или более

Примечание: Итого по Дании, Франции, Нидерландам, США.

Добавить комментарий

Ваш адрес email не будет опубликован.

2019 © Все права защищены. Карта сайта